pycom15g02300
MYB Family

radialis-like

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Reverse (-)
1353128 .. 1353855
728 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom15g02300.1

Sequence Viewer

Length: 288 bp
ATGGCGTCGTCAGGATCGTGGACGGCAAGGCAAAACAAGCTGTTTGAGAATGCTCTGGCGGTTTACGACAAGGATACGCCTGACAGGTGGCACAATCTGGCGACGGCTGTGGGTGGGAAATCAGTGGAGGAAGTGAAGAGGCACTATCAGATGCTTGTGGAAGATGTAAGCAAGATTGAGGCTGGTGAGGTGCCTTTGCCTAATTATAGAAAATCTGGTGGAGGAAGCACTAAGTCCTATTCCAGGGATATTGAAGAAGAAAGGATGAAGAGTCTAAGAATTCAATGA

Protein Analysis

96

Amino Acids

10.73

Weight (kDa)

7.99

Isoelectric Point (pI)

62.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 5 - 52 2.1e-06 Myb-like DNA-binding domain
Myb_DNA-binding_2 PF23082 6 - 53 5.1e-06 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016776)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 190
AciI CCGC 1 cut(s) 59
AclWI GGATC 1 cut(s) 22
AcsI RAATTY 1 cut(s) 279
AcyI GRCGYC 1 cut(s) 5
AfiI CCNNNNNNNGG 1 cut(s) 243
AgsI TTSAA 2 cut(s) 254, 284
AjnI CCWGG 1 cut(s) 242
AluBI AGCT 1 cut(s) 40
AluI AGCT 1 cut(s) 40
AlwI GGATC 1 cut(s) 22
ApoI RAATTY 1 cut(s) 279
AsuHPI GGTGA 1 cut(s) 197
BanI GGYRCC 1 cut(s) 190
BceAI ACGGC 2 cut(s) 39, 120
BciT130I CCWGG 1 cut(s) 244
BciVI GTATCC 1 cut(s) 67
BfuI GTATCC 1 cut(s) 67
Bme1390I CCNGG 1 cut(s) 244
BmiI GGNNCC 1 cut(s) 192
BmrFI CCNGG 1 cut(s) 244
BmsI GCATC 1 cut(s) 141
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 243
Bsc4I CCNNNNNNNGG 1 cut(s) 243
BseBI CCWGG 1 cut(s) 244
BseDI CCNNGG 1 cut(s) 243
BseGI GGATG 1 cut(s) 270
BseLI CCNNNNNNNGG 1 cut(s) 243
BshNI GGYRCC 1 cut(s) 190
BslI CCNNNNNNNGG 1 cut(s) 243
BsmI GAATGC 1 cut(s) 55
Bsp143I GATC 1 cut(s) 14
BspACI CCGC 1 cut(s) 59
BspLI GGNNCC 1 cut(s) 192
BspPI GGATC 1 cut(s) 22
BspT107I GGYRCC 1 cut(s) 190
BssECI CCNNGG 1 cut(s) 243
BssMI GATC 1 cut(s) 14
BssNI GRCGYC 1 cut(s) 5
Bst2UI CCWGG 1 cut(s) 244
Bst6I CTCTTC 2 cut(s) 131, 263
BstACI GRCGYC 1 cut(s) 5
BstDEI CTNAG 2 cut(s) 231, 275
BstENI CCTNNNNNAGG 1 cut(s) 241
BstF5I GGATG 1 cut(s) 270
BstKTI GATC 1 cut(s) 17
BstMBI GATC 1 cut(s) 14
BstMWI GCNNNNNNNGC 1 cut(s) 37
BstNI CCWGG 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 242
BsuI GTATCC 1 cut(s) 67
BtsCI GGATG 1 cut(s) 270
BtsIMutI CAGTG 1 cut(s) 129
CviJI RGCY 3 cut(s) 40, 107, 182
CviKI_1 RGCY 3 cut(s) 40, 107, 182
DdeI CTNAG 2 cut(s) 231, 275
DpnI GATC 1 cut(s) 16
DpnII GATC 1 cut(s) 14
Eam1104I CTCTTC 2 cut(s) 131, 263
EarI CTCTTC 2 cut(s) 131, 263
EcoNI CCTNNNNNAGG 1 cut(s) 241
EcoRI GAATTC 1 cut(s) 279
EcoRII CCWGG 1 cut(s) 242
FaiI YATR 1 cut(s) 207
FokI GGATG 1 cut(s) 277
Hin1I GRCGYC 1 cut(s) 5
HinfI GANTC 1 cut(s) 271
HphI GGTGA 1 cut(s) 197
Hpy166II GTNNAC 2 cut(s) 21, 64
Hpy188I TCNGA 1 cut(s) 150
Hpy188III TCNNGA 1 cut(s) 12
Hpy8I GTNNAC 2 cut(s) 21, 64
Hpy99I CGWCG 2 cut(s) 10, 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 37
HpyF3I CTNAG 2 cut(s) 231, 275
Hsp92I GRCGYC 1 cut(s) 5
Kzo9I GATC 1 cut(s) 14
LpnPI CCDG 8 cut(s) 41, 70, 83, 93, 168, 201, 229, 256
LweI GCATC 1 cut(s) 141
MalI GATC 1 cut(s) 16
MboI GATC 1 cut(s) 14
MboII GAAGA 5 cut(s) 148, 173, 266, 269, 280
MluCI AATT 2 cut(s) 202, 279
MlyI GAGTC 1 cut(s) 280
MnlI CCTC 5 cut(s) 121, 132, 172, 181, 215
MspR9I CCNGG 1 cut(s) 244
Mva1269I GAATGC 1 cut(s) 55
MvaI CCWGG 1 cut(s) 244
MwoI GCNNNNNNNGC 1 cut(s) 37
NdeII GATC 1 cut(s) 14
NlaIV GGNNCC 1 cut(s) 192
PcsI WCGNNNNNNNCGW 1 cut(s) 14
PctI GAATGC 1 cut(s) 55
PleI GAGTC 1 cut(s) 279
PpsI GAGTC 1 cut(s) 279
Psp6I CCWGG 1 cut(s) 242
PspGI CCWGG 1 cut(s) 242
PspN4I GGNNCC 1 cut(s) 192
Sau3AI GATC 1 cut(s) 14
SchI GAGTC 1 cut(s) 280
ScrFI CCNGG 1 cut(s) 244
SetI ASST 3 cut(s) 42, 89, 192
SfaNI GCATC 1 cut(s) 141
Sse9I AATT 2 cut(s) 202, 279
SsiI CCGC 1 cut(s) 59
StyD4I CCNGG 1 cut(s) 242
TasI AATT 2 cut(s) 202, 279
TscAI CASTG 1 cut(s) 129
TspDTI ATGAA 1 cut(s) 281
TspRI CASTG 1 cut(s) 129
XagI CCTNNNNNAGG 1 cut(s) 241
XapI RAATTY 1 cut(s) 279
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.