pycom15g25830

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr15
Physical Location & Seq
Forward (+)
20506847 .. 20507849
1003 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 267 bp
ATGGACCCTAGATACACAGGAGAGATATTGAAGCATTTGGAGAAGCAAAACGAGCTCCTCATGGAAGCCAAAATATCAATGTCCGAGGAATTGCATCAACTGAAGGTAGAAGAGGAAATGCTGATGCGTAAGTTTTATGAGATTATGTCAGCTCATGGTAAAGTGAAAAAGAATGGAGATGGTGGTAAAGTTTCAGATGATGGTGAAATTGGAAGTTCCACAGCGTTAGCCGTAGCCAACACAACTAACGATGAGGAATGCCGATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.92

Weight (kDa)

5.02

Isoelectric Point (pI)

38.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 122
AgsI TTSAA 1 cut(s) 31
AluBI AGCT 2 cut(s) 55, 152
AluI AGCT 2 cut(s) 55, 152
Alw21I GWGCWC 1 cut(s) 57
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 215
AvaII GGWCC 1 cut(s) 4
BanII GRGCYC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 57
BccI CCATC 2 cut(s) 173, 194
BceAI ACGGC 1 cut(s) 215
BfaI CTAG 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 4
BmgT120I GGNCC 1 cut(s) 4
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 103, 114
BsaJI CCNNGG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 84
BseRI GAGGAG 1 cut(s) 47
BsiHKAI GWGCWC 1 cut(s) 57
BsmI GAATGC 1 cut(s) 263
Bsp1286I GDGCHC 1 cut(s) 57
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 84
Bst6I CTCTTC 1 cut(s) 105
BstMWI GCNNNNNNNGC 1 cut(s) 52
Cfr13I GGNCC 1 cut(s) 4
CviAII CATG 2 cut(s) 61, 155
CviJI RGCY 5 cut(s) 55, 68, 152, 230, 236
CviKI_1 RGCY 5 cut(s) 55, 68, 152, 230, 236
Eam1104I CTCTTC 1 cut(s) 105
EarI CTCTTC 1 cut(s) 105
Ecl136II GAGCTC 1 cut(s) 55
Eco24I GRGCYC 1 cut(s) 57
Eco47I GGWCC 1 cut(s) 4
Eco53kI GAGCTC 1 cut(s) 55
Eco57I CTGAAG 1 cut(s) 122
EcoICRI GAGCTC 1 cut(s) 55
EcoT38I GRGCYC 1 cut(s) 57
FaeI CATG 2 cut(s) 64, 158
FaiI YATR 4 cut(s) 62, 138, 146, 156
FatI CATG 2 cut(s) 60, 154
FriOI GRGCYC 1 cut(s) 57
FspBI CTAG 1 cut(s) 9
Hin1II CATG 2 cut(s) 64, 158
HphI GGTGA 1 cut(s) 215
Hpy188I TCNGA 2 cut(s) 85, 196
HpyAV CCTTC 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 1 cut(s) 52
Hsp92II CATG 2 cut(s) 64, 158
LmnI GCTCC 1 cut(s) 60
LpnPI CCDG 1 cut(s) 3
LweI GCATC 2 cut(s) 103, 114
MaeI CTAG 1 cut(s) 9
MboII GAAGA 1 cut(s) 122
MhlI GDGCHC 1 cut(s) 57
MluCI AATT 2 cut(s) 89, 207
MnlI CCTC 4 cut(s) 68, 79, 106, 247
Mva1269I GAATGC 1 cut(s) 263
MwoI GCNNNNNNNGC 1 cut(s) 52
NlaIII CATG 2 cut(s) 64, 158
NlaIV GGNNCC 1 cut(s) 6
PctI GAATGC 1 cut(s) 263
Psp124BI GAGCTC 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 4
SacI GAGCTC 1 cut(s) 57
Sau96I GGNCC 1 cut(s) 4
SduI GDGCHC 1 cut(s) 57
SetI ASST 3 cut(s) 57, 108, 154
SfaNI GCATC 2 cut(s) 103, 114
SgeI CNNG 6 cut(s) 21, 30, 64, 73, 97, 167
SinI GGWCC 1 cut(s) 4
Sse9I AATT 2 cut(s) 89, 207
SspMI CTAG 1 cut(s) 9
SstI GAGCTC 1 cut(s) 57
TasI AATT 2 cut(s) 89, 207
VpaK11BI GGWCC 1 cut(s) 4
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.