pycom17g07820

Epidermal patterning factor proteins

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
OG0016712
Physical Location & Seq
Forward (+)
5774622 .. 5775097
476 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 354 bp
ATGAAGGGTTCAATTTGTGTAGCTACATTTCTTGTTCTTCTTCTTTTACTTCCACAAGCCATGTCCGCAAGGCGCATAGCTCGGCCTCATTCACGTCATCATGGGCGCCATCTGAAGAGTACCATTAGAGAAGGATTAGTGGATAAAGAGTCAATTAATTACAAAAGAGTTAGGGGGCCAGATACACTCCAAGTGGCAGGGTCGAGCTTGCCAGATTGCTCCCATGCTTGTGGATCTTGCAGACCATGCAGACTAGTGATGGTGAGCTTAGTTTGCGCGTCAGTCGCTGAGTCTGAGACATGTCCAATGGCTTACAAGTGCATGTGCAATAACAAGTCCTATCCTGTTCCTTAG

Protein Analysis

118

Amino Acids

12.81

Weight (kDa)

9.37

Isoelectric Point (pI)

53.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EPF PF17181 66 - 115 3.9e-15 Epidermal patterning factor proteins
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016712)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G20875
fragaria_vesca FvH4_6g45090
malus_domestica MD09G1089600.v1.1 MD17G1079000.v1.1
prunus_persica Prupe.3G235800_v2.0.a1
pyrus_communis pycom09g01470 pycom17g07820
rosa_chinensis RchiOBHm_Chr2g0162501
rosa_multiflora Rmu_co8426761.1_g000001 Rmu_sc0004206.1_g000014
rosa_roxburghii Rroxscaffold_2G00087890
rosa_samantha Rh2AG564000 Rh2CG546600
rosa_wichuraiana Rw2G046660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 105
AccII CGCG 1 cut(s) 278
AciI CCGC 1 cut(s) 66
AclWI GGATC 1 cut(s) 241
AcuI CTGAAG 1 cut(s) 134
AcyI GRCGYC 1 cut(s) 106
AfaI GTAC 1 cut(s) 121
AflIII ACRYGT 1 cut(s) 299
AgsI TTSAA 1 cut(s) 12
AhlI ACTAGT 1 cut(s) 253
AjiI CACGTC 1 cut(s) 95
AluBI AGCT 4 cut(s) 23, 80, 207, 267
AluI AGCT 4 cut(s) 23, 80, 207, 267
Alw26I GTCTC 1 cut(s) 290
AlwI GGATC 1 cut(s) 241
AlwNI CAGNNNCTG 1 cut(s) 287
AoxI GGCC 2 cut(s) 83, 176
AseI ATTAAT 1 cut(s) 156
AspLEI GCGC 3 cut(s) 75, 108, 278
AspS9I GGNCC 1 cut(s) 176
AsuHPI GGTGA 1 cut(s) 274
BanI GGYRCC 1 cut(s) 105
BccI CCATC 2 cut(s) 117, 253
BcoDI GTCTC 1 cut(s) 290
BcuI ACTAGT 1 cut(s) 253
BfaI CTAG 1 cut(s) 254
BfoI RGCGCY 1 cut(s) 109
BmgBI CACGTC 1 cut(s) 95
BmgT120I GGNCC 1 cut(s) 176
BmiI GGNNCC 2 cut(s) 107, 177
BsaHI GRCGYC 1 cut(s) 106
BseMII CTCAG 2 cut(s) 279, 285
Bsh1236I CGCG 1 cut(s) 278
BshFI GGCC 2 cut(s) 85, 178
BshNI GGYRCC 1 cut(s) 105
BsmAI GTCTC 1 cut(s) 290
BsnI GGCC 2 cut(s) 85, 178
Bsp143I GATC 1 cut(s) 233
BspACI CCGC 1 cut(s) 66
BspANI GGCC 2 cut(s) 85, 178
BspCNI CTCAG 2 cut(s) 280, 286
BspFNI CGCG 1 cut(s) 278
BspLI GGNNCC 2 cut(s) 107, 177
BspPI GGATC 1 cut(s) 241
BspT107I GGYRCC 1 cut(s) 105
BssMI GATC 1 cut(s) 233
BssNI GRCGYC 1 cut(s) 106
Bst6I CTCTTC 1 cut(s) 110
BstACI GRCGYC 1 cut(s) 106
BstAPI GCANNNNNTGC 1 cut(s) 246
BstC8I GCNNGC 1 cut(s) 209
BstDEI CTNAG 4 cut(s) 268, 288, 294, 351
BstFNI CGCG 1 cut(s) 278
BstH2I RGCGCY 1 cut(s) 109
BstHHI GCGC 3 cut(s) 75, 108, 278
BstKTI GATC 1 cut(s) 236
BstMAI GTCTC 1 cut(s) 290
BstMBI GATC 1 cut(s) 233
BstMWI GCNNNNNNNGC 4 cut(s) 65, 246, 273, 284
BstNSI RCATGY 2 cut(s) 303, 325
BstUI CGCG 1 cut(s) 278
BstX2I RGATCY 1 cut(s) 233
BstXI CCANNNNNNTGG 1 cut(s) 230
BstYI RGATCY 1 cut(s) 233
BsuRI GGCC 2 cut(s) 85, 178
BtrI CACGTC 1 cut(s) 95
Cac8I GCNNGC 1 cut(s) 209
CaiI CAGNNNCTG 1 cut(s) 287
CfoI GCGC 3 cut(s) 75, 108, 278
Cfr13I GGNCC 1 cut(s) 176
CseI GACGC 1 cut(s) 267
Csp6I GTAC 1 cut(s) 120
CviAII CATG 6 cut(s) 61, 101, 224, 246, 300, 322
CviJI RGCY 8 cut(s) 23, 59, 80, 85, 178, 207, 267, 311
CviKI_1 RGCY 8 cut(s) 23, 59, 80, 85, 178, 207, 267, 311
CviQI GTAC 1 cut(s) 120
DdeI CTNAG 4 cut(s) 268, 288, 294, 351
DinI GGCGCC 1 cut(s) 107
DpnI GATC 1 cut(s) 235
DpnII GATC 1 cut(s) 233
Eam1104I CTCTTC 1 cut(s) 110
EarI CTCTTC 1 cut(s) 110
Eco57I CTGAAG 1 cut(s) 134
EgeI GGCGCC 1 cut(s) 107
EheI GGCGCC 1 cut(s) 107
FaeI CATG 6 cut(s) 64, 104, 227, 249, 303, 325
FaiI YATR 7 cut(s) 62, 77, 102, 225, 247, 301, 323
FatI CATG 6 cut(s) 60, 100, 223, 245, 299, 321
FspBI CTAG 1 cut(s) 254
GlaI GCGC 3 cut(s) 74, 107, 277
HaeII RGCGCY 1 cut(s) 109
HaeIII GGCC 2 cut(s) 85, 178
HgaI GACGC 1 cut(s) 267
HhaI GCGC 3 cut(s) 75, 108, 278
Hin1I GRCGYC 1 cut(s) 106
Hin1II CATG 6 cut(s) 64, 104, 227, 249, 303, 325
Hin6I GCGC 3 cut(s) 73, 106, 276
HinP1I GCGC 3 cut(s) 73, 106, 276
HinfI GANTC 2 cut(s) 149, 290
HphI GGTGA 1 cut(s) 274
Hpy188I TCNGA 2 cut(s) 114, 295
HpyAV CCTTC 1 cut(s) 125
HpyCH4IV ACGT 1 cut(s) 94
HpyCH4V TGCA 4 cut(s) 240, 249, 321, 327
HpyF10VI GCNNNNNNNGC 4 cut(s) 65, 246, 273, 284
HpyF3I CTNAG 4 cut(s) 268, 288, 294, 351
HpySE526I ACGT 1 cut(s) 94
Hsp92I GRCGYC 1 cut(s) 106
Hsp92II CATG 6 cut(s) 64, 104, 227, 249, 303, 325
HspAI GCGC 3 cut(s) 73, 106, 276
KasI GGCGCC 1 cut(s) 105
Kzo9I GATC 1 cut(s) 233
LmnI GCTCC 1 cut(s) 224
LpnPI CCDG 3 cut(s) 183, 192, 225
MaeI CTAG 1 cut(s) 254
MaeII ACGT 1 cut(s) 94
MalI GATC 1 cut(s) 235
MboI GATC 1 cut(s) 233
MboII GAAGA 3 cut(s) 29, 32, 127
MflI RGATCY 1 cut(s) 233
MluCI AATT 3 cut(s) 12, 153, 157
Mly113I GGCGCC 1 cut(s) 106
MlyI GAGTC 2 cut(s) 158, 299
MnlI CCTC 1 cut(s) 96
MseI TTAA 1 cut(s) 156
MslI CAYNNNNRTG 1 cut(s) 228
MvnI CGCG 1 cut(s) 278
MwoI GCNNNNNNNGC 4 cut(s) 65, 246, 273, 284
NarI GGCGCC 1 cut(s) 106
NdeII GATC 1 cut(s) 233
NlaIII CATG 6 cut(s) 64, 104, 227, 249, 303, 325
NlaIV GGNNCC 2 cut(s) 107, 177
NmeAIII GCCGAG 1 cut(s) 61
NspI RCATGY 2 cut(s) 303, 325
PciI ACATGT 1 cut(s) 299
PleI GAGTC 2 cut(s) 157, 298
PluTI GGCGCC 1 cut(s) 109
PpsI GAGTC 2 cut(s) 157, 298
PscI ACATGT 1 cut(s) 299
PshBI ATTAAT 1 cut(s) 156
PspN4I GGNNCC 2 cut(s) 107, 177
PspPI GGNCC 1 cut(s) 176
PstNI CAGNNNCTG 1 cut(s) 287
PsuI RGATCY 1 cut(s) 233
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
RseI CAYNNNNRTG 1 cut(s) 228
SaqAI TTAA 1 cut(s) 156
Sau3AI GATC 1 cut(s) 233
Sau96I GGNCC 1 cut(s) 176
SchI GAGTC 2 cut(s) 158, 299
SetI ASST 5 cut(s) 25, 82, 97, 209, 269
SfoI GGCGCC 1 cut(s) 107
SmiMI CAYNNNNRTG 1 cut(s) 228
SpeI ACTAGT 1 cut(s) 253
Sse9I AATT 3 cut(s) 12, 153, 157
SsiI CCGC 1 cut(s) 66
SspDI GGCGCC 1 cut(s) 105
SspMI CTAG 1 cut(s) 254
TaiI ACGT 1 cut(s) 97
TaqI TCGA 1 cut(s) 203
TasI AATT 3 cut(s) 12, 153, 157
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TspDTI ATGAA 1 cut(s) 17
VspI ATTAAT 1 cut(s) 156
XceI RCATGY 2 cut(s) 303, 325
XspI CTAG 1 cut(s) 254
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.