pycom17g14910

Calcineurin-like phosphoesterase

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
12650553 .. 12650938
386 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g14910.1

Sequence Viewer

Length: 183 bp
ATGGCTTTTCAGATGCTGAGTTTACCACGGATTCTGCGATCTGCTAATGGTCAAGAAGTAATGAATCGGAATTACATTACAGAGGAATCATCAAACTACTTATTGGATTCAATTAAACTGGTTAGTGCTGTATCCTCTCTATCATGCATCTTGTCTGCAAGATCAGTGCCGTGTGATCCATAA

Protein Analysis

61

Amino Acids

6.62

Weight (kDa)

6.03

Isoelectric Point (pI)

70.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 170
AgsI TTSAA 1 cut(s) 111
AlwI GGATC 1 cut(s) 170
AlwNI CAGNNNCTG 1 cut(s) 16
BceAI ACGGC 1 cut(s) 154
BciVI GTATCC 1 cut(s) 142
BfuI GTATCC 1 cut(s) 142
BmsI GCATC 2 cut(s) 3, 156
BsaJI CCNNGG 1 cut(s) 26
Bse1I ACTGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 26
BseMII CTCAG 1 cut(s) 8
BseNI ACTGG 1 cut(s) 123
Bsp143I GATC 3 cut(s) 38, 161, 175
BspCNI CTCAG 1 cut(s) 9
BspPI GGATC 1 cut(s) 170
BsrI ACTGG 1 cut(s) 123
BssECI CCNNGG 1 cut(s) 26
BssMI GATC 3 cut(s) 38, 161, 175
BstDEI CTNAG 1 cut(s) 17
BstDSI CCRYGG 1 cut(s) 26
BstKTI GATC 3 cut(s) 41, 164, 178
BstMBI GATC 3 cut(s) 38, 161, 175
BsuI GTATCC 1 cut(s) 142
BtgI CCRYGG 1 cut(s) 26
BtsIMutI CAGTG 1 cut(s) 171
CaiI CAGNNNCTG 1 cut(s) 16
CviAII CATG 1 cut(s) 144
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 17
DpnI GATC 3 cut(s) 40, 163, 177
DpnII GATC 3 cut(s) 38, 161, 175
EcoT22I ATGCAT 1 cut(s) 149
FaeI CATG 1 cut(s) 147
FaiI YATR 2 cut(s) 145, 181
FatI CATG 1 cut(s) 143
FspEI CC 8 cut(s) 13, 33, 39, 52, 68, 89, 104, 148
Hin1II CATG 1 cut(s) 147
HinfI GANTC 4 cut(s) 31, 64, 86, 107
Hpy166II GTNNAC 1 cut(s) 23
Hpy188I TCNGA 2 cut(s) 12, 69
Hpy188III TCNNGA 1 cut(s) 53
Hpy8I GTNNAC 1 cut(s) 23
HpyCH4V TGCA 2 cut(s) 147, 158
HpyF3I CTNAG 1 cut(s) 17
Hsp92II CATG 1 cut(s) 147
Kzo9I GATC 3 cut(s) 38, 161, 175
LpnPI CCDG 1 cut(s) 104
LweI GCATC 2 cut(s) 3, 156
MalI GATC 3 cut(s) 40, 163, 177
MboI GATC 3 cut(s) 38, 161, 175
MluCI AATT 2 cut(s) 70, 111
MnlI CCTC 2 cut(s) 76, 145
Mph1103I ATGCAT 1 cut(s) 149
MseI TTAA 1 cut(s) 114
NdeII GATC 3 cut(s) 38, 161, 175
NlaIII CATG 1 cut(s) 147
NsiI ATGCAT 1 cut(s) 149
PcsI WCGNNNNNNNCGW 1 cut(s) 34
PfeI GAWTC 4 cut(s) 31, 64, 86, 107
PstNI CAGNNNCTG 1 cut(s) 16
SaqAI TTAA 1 cut(s) 114
Sau3AI GATC 3 cut(s) 38, 161, 175
SfaNI GCATC 2 cut(s) 3, 156
SgeI CNNG 6 cut(s) 39, 65, 131, 156, 163, 171
Sse9I AATT 2 cut(s) 70, 111
TasI AATT 2 cut(s) 70, 111
TfiI GAWTC 4 cut(s) 31, 64, 86, 107
Tru1I TTAA 1 cut(s) 114
Tru9I TTAA 1 cut(s) 114
TscAI CASTG 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 77
TspGWI ACGGA 1 cut(s) 43
TspRI CASTG 1 cut(s) 171
Zsp2I ATGCAT 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.