pycom17g15780

U6 snRNA-associated Sm-like protein

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr17
Physical Location & Seq
Reverse (-)
13838971 .. 13839863
893 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom17g15780.3

Sequence Viewer

Length: 330 bp
ATGTCTTGGGCAGGCCCAGAAGATGTCTACCTTTCCACTTCTCTGGCCAGCTATCTTGACAAGAAACTTCTTGTGCTGCTCCGTGATGGTCGAAAACTTTTGGGGATACTTCGATCGTTTGATCAATTTGCCAATGCTGTTCTCGAGGGTGCTTGTGAGAGAGTCATTGTTGGCGATCTTTACTGTGATATCCCTTTGGGTCTGTATGTAATCCGTGGGGAGAATGTTGTTCTAATCGGCGAGCTGGATTCAGAGAGGGAGGAACTTCCACCGCACATGACTCGTGTTTCAGCTGCAGAAATTAAAAGGGTAAGTGTTATCAGCTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.06

Weight (kDa)

4.93

Isoelectric Point (pI)

38.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011858)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 27
AciI CCGC 1 cut(s) 272
AcoI YGGCCR 1 cut(s) 45
AluBI AGCT 4 cut(s) 51, 244, 293, 324
AluI AGCT 4 cut(s) 51, 244, 293, 324
Ama87I CYCGRG 1 cut(s) 143
AoxI GGCC 2 cut(s) 13, 45
ApeKI GCWGC 2 cut(s) 76, 293
AspS9I GGNCC 1 cut(s) 14
AvaI CYCGRG 1 cut(s) 143
BalI TGGCCA 1 cut(s) 47
BauI CACGAG 1 cut(s) 282
BbvI GCAGC 2 cut(s) 63, 280
BccI CCATC 1 cut(s) 80
BcgI CGANNNNNNTGC 2 cut(s) 263, 297
BciVI GTATCC 1 cut(s) 99
BclI TGATCA 1 cut(s) 121
BfmI CTRYAG 1 cut(s) 294
BfuI GTATCC 1 cut(s) 99
BisI GCNGC 2 cut(s) 77, 294
BlsI GCNGC 2 cut(s) 78, 295
BmeT110I CYCGRG 1 cut(s) 143
BmgT120I GGNCC 1 cut(s) 14
BsaJI CCNNGG 1 cut(s) 214
BseDI CCNNGG 1 cut(s) 214
BseXI GCAGC 2 cut(s) 63, 280
Bsh1285I CGRYCG 1 cut(s) 116
BshFI GGCC 2 cut(s) 15, 47
BsiEI CGRYCG 1 cut(s) 116
BsiHKCI CYCGRG 1 cut(s) 143
BsnI GGCC 2 cut(s) 15, 47
BsoBI CYCGRG 1 cut(s) 143
Bsp143I GATC 3 cut(s) 113, 121, 175
BspACI CCGC 1 cut(s) 272
BspANI GGCC 2 cut(s) 15, 47
BspMAI CTGCAG 1 cut(s) 298
BssECI CCNNGG 1 cut(s) 214
BssMI GATC 3 cut(s) 113, 121, 175
BssSI CACGAG 1 cut(s) 282
Bst2BI CACGAG 1 cut(s) 282
Bst4CI ACNGT 1 cut(s) 185
BstC8I GCNNGC 3 cut(s) 13, 49, 242
BstDSI CCRYGG 1 cut(s) 214
BstKTI GATC 3 cut(s) 116, 124, 178
BstMBI GATC 3 cut(s) 113, 121, 175
BstMCI CGRYCG 1 cut(s) 116
BstSFI CTRYAG 1 cut(s) 294
BstV1I GCAGC 2 cut(s) 63, 280
BstXI CCANNNNNNTGG 1 cut(s) 43
BsuI GTATCC 1 cut(s) 99
BsuRI GGCC 2 cut(s) 15, 47
BtgI CCRYGG 1 cut(s) 214
Cac8I GCNNGC 3 cut(s) 13, 49, 242
Cfr13I GGNCC 1 cut(s) 14
CviAII CATG 1 cut(s) 277
CviJI RGCY 6 cut(s) 15, 47, 51, 244, 293, 324
CviKI_1 RGCY 6 cut(s) 15, 47, 51, 244, 293, 324
DpnI GATC 3 cut(s) 115, 123, 177
DpnII GATC 3 cut(s) 113, 121, 175
EaeI YGGCCR 1 cut(s) 45
Eco32I GATATC 1 cut(s) 190
Eco88I CYCGRG 1 cut(s) 143
EcoRV GATATC 1 cut(s) 190
FaeI CATG 1 cut(s) 280
FaiI YATR 3 cut(s) 207, 278, 328
FatI CATG 1 cut(s) 276
FbaI TGATCA 1 cut(s) 121
FblI GTMKAC 1 cut(s) 27
Fnu4HI GCNGC 2 cut(s) 77, 294
Fsp4HI GCNGC 2 cut(s) 77, 294
GluI GCNGC 2 cut(s) 77, 294
HaeIII GGCC 2 cut(s) 15, 47
Hin1II CATG 1 cut(s) 280
HinfI GANTC 3 cut(s) 162, 248, 280
Hpy166II GTNNAC 1 cut(s) 28
Hpy188I TCNGA 1 cut(s) 253
Hpy188III TCNNGA 2 cut(s) 56, 143
Hpy8I GTNNAC 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 185
HpyCH4V TGCA 1 cut(s) 296
Hsp92II CATG 1 cut(s) 280
Ksp22I TGATCA 1 cut(s) 121
Kzo9I GATC 3 cut(s) 113, 121, 175
LmnI GCTCC 1 cut(s) 84
LpnPI CCDG 4 cut(s) 29, 30, 61, 230
Lsp1109I GCAGC 2 cut(s) 63, 280
MalI GATC 3 cut(s) 115, 123, 177
MboI GATC 3 cut(s) 113, 121, 175
MboII GAAGA 1 cut(s) 32
MlsI TGGCCA 1 cut(s) 47
MluCI AATT 2 cut(s) 125, 300
MluNI TGGCCA 1 cut(s) 47
MlyI GAGTC 2 cut(s) 171, 274
MnlI CCTC 3 cut(s) 139, 249, 253
Mox20I TGGCCA 1 cut(s) 47
MscI TGGCCA 1 cut(s) 47
MseI TTAA 1 cut(s) 303
Msp20I TGGCCA 1 cut(s) 47
MspA1I CMGCKG 1 cut(s) 293
NdeII GATC 3 cut(s) 113, 121, 175
NlaIII CATG 1 cut(s) 280
PaeR7I CTCGAG 1 cut(s) 143
PfeI GAWTC 1 cut(s) 248
PkrI GCNGC 2 cut(s) 78, 295
Ple19I CGATCG 1 cut(s) 116
PleI GAGTC 2 cut(s) 170, 274
PpsI GAGTC 2 cut(s) 170, 274
PspPI GGNCC 1 cut(s) 14
PstI CTGCAG 1 cut(s) 298
PvuI CGATCG 1 cut(s) 116
PvuII CAGCTG 1 cut(s) 293
SaqAI TTAA 1 cut(s) 303
SatI GCNGC 2 cut(s) 77, 294
Sau3AI GATC 3 cut(s) 113, 121, 175
Sau96I GGNCC 1 cut(s) 14
SchI GAGTC 2 cut(s) 171, 274
SetI ASST 5 cut(s) 33, 53, 246, 295, 326
SfcI CTRYAG 1 cut(s) 294
Sfr274I CTCGAG 1 cut(s) 143
SlaI CTCGAG 1 cut(s) 143
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
Sse9I AATT 2 cut(s) 125, 300
SsiI CCGC 1 cut(s) 272
TaaI ACNGT 1 cut(s) 185
TaqI TCGA 3 cut(s) 91, 112, 144
TasI AATT 2 cut(s) 125, 300
TfiI GAWTC 1 cut(s) 248
Tru1I TTAA 1 cut(s) 303
Tru9I TTAA 1 cut(s) 303
TseI GCWGC 2 cut(s) 76, 293
TspGWI ACGGA 2 cut(s) 71, 203
XhoI CTCGAG 1 cut(s) 143
XmiI GTMKAC 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.