pycom290g00110

Glucose-1-phosphate adenylyltransferase small subunit

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_290
Physical Location & Seq
Reverse (-)
104574 .. 104885
312 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGAGGACGAGAATCGGAAATGGGGCTATAGTCGAGGATTCAGTTGTCATGGGTTCAACTATGTACCAATCACAGATAGAAGATAGAGGGAAGAGGAAAGGCATGGCGGGTGTGATCCCTGGGATGGGAATTGGCGAAGATACTCATGTAAGGAAGGCTATTATAGACAAGAATGCAAGAATTGGCAACAATGTTATGGTATGTATGAATGTATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

73

Amino Acids

7.84

Weight (kDa)

9.43

Isoelectric Point (pI)

30.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LbH_GLGC PF25247 1 - 68 9e-18 GLGC left-handed parallel beta-helix domain
Hexapep_GlmU PF24894 4 - 70 1e-05 GlmU-like, C-terminal hexapeptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016577)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 213
AciI CCGC 1 cut(s) 107
AclWI GGATC 1 cut(s) 109
AfaI GTAC 1 cut(s) 65
AfiI CCNNNNNNNGG 2 cut(s) 124, 125
AgsI TTSAA 1 cut(s) 57
AjnI CCWGG 1 cut(s) 118
AlwI GGATC 1 cut(s) 109
BaeI ACNNNNGTAYC 2 cut(s) 132, 165
BccI CCATC 1 cut(s) 118
BciT130I CCWGG 1 cut(s) 120
BfaI CTAG 1 cut(s) 217
BfmI CTRYAG 1 cut(s) 27
Bme1390I CCNGG 1 cut(s) 120
BmrFI CCNGG 1 cut(s) 120
BsaJI CCNNGG 2 cut(s) 118, 119
Bsc4I CCNNNNNNNGG 2 cut(s) 124, 125
BseBI CCWGG 1 cut(s) 120
BseDI CCNNGG 2 cut(s) 118, 119
BseGI GGATG 1 cut(s) 129
BseLI CCNNNNNNNGG 2 cut(s) 124, 125
BslI CCNNNNNNNGG 2 cut(s) 124, 125
BsmI GAATGC 1 cut(s) 178
Bsp143I GATC 1 cut(s) 114
BspACI CCGC 1 cut(s) 107
BspPI GGATC 1 cut(s) 109
BssECI CCNNGG 2 cut(s) 118, 119
BssMI GATC 1 cut(s) 114
BssNAI GTATAC 1 cut(s) 214
Bst1107I GTATAC 1 cut(s) 214
Bst2UI CCWGG 1 cut(s) 120
Bst6I CTCTTC 1 cut(s) 86
BstF5I GGATG 1 cut(s) 129
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstNI CCWGG 1 cut(s) 120
BstSCI CCNGG 1 cut(s) 118
BstSFI CTRYAG 1 cut(s) 27
BstZ17I GTATAC 1 cut(s) 214
BtsCI GGATG 1 cut(s) 129
Csp6I GTAC 1 cut(s) 64
CviAII CATG 3 cut(s) 49, 103, 146
CviJI RGCY 2 cut(s) 26, 158
CviKI_1 RGCY 2 cut(s) 26, 158
CviQI GTAC 1 cut(s) 64
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
EcoRII CCWGG 1 cut(s) 118
FaeI CATG 3 cut(s) 52, 106, 149
FatI CATG 3 cut(s) 48, 102, 145
FauI CCCGC 1 cut(s) 100
FblI GTMKAC 1 cut(s) 213
FokI GGATG 1 cut(s) 136
FspBI CTAG 1 cut(s) 217
Hin1II CATG 3 cut(s) 52, 106, 149
HinfI GANTC 2 cut(s) 12, 38
Hpy166II GTNNAC 1 cut(s) 214
Hpy188I TCNGA 1 cut(s) 17
Hpy8I GTNNAC 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 148
HpyCH4V TGCA 1 cut(s) 176
Hsp92II CATG 3 cut(s) 52, 106, 149
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 2 cut(s) 105, 132
MaeI CTAG 1 cut(s) 217
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
MboII GAAGA 3 cut(s) 92, 103, 149
MluCI AATT 2 cut(s) 129, 180
MnlI CCTC 3 cut(s) 28, 80, 87
MspR9I CCNGG 1 cut(s) 120
Mva1269I GAATGC 1 cut(s) 178
MvaI CCWGG 1 cut(s) 120
NdeII GATC 1 cut(s) 114
NlaIII CATG 3 cut(s) 52, 106, 149
PasI CCCWGGG 1 cut(s) 119
PctI GAATGC 1 cut(s) 178
PfeI GAWTC 2 cut(s) 12, 38
Psp6I CCWGG 1 cut(s) 118
PspGI CCWGG 1 cut(s) 118
RsaI GTAC 1 cut(s) 65
RsaNI GTAC 1 cut(s) 64
Sau3AI GATC 1 cut(s) 114
ScrFI CCNGG 1 cut(s) 120
SfcI CTRYAG 1 cut(s) 27
Sse9I AATT 2 cut(s) 129, 180
SsiI CCGC 1 cut(s) 107
SspMI CTAG 1 cut(s) 217
StyD4I CCNGG 1 cut(s) 118
TaqI TCGA 1 cut(s) 33
TasI AATT 2 cut(s) 129, 180
TfiI GAWTC 2 cut(s) 12, 38
XmiI GTMKAC 1 cut(s) 213
XspI CTAG 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.