Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co8406699.1

Orthogroup ID

OG0016577

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 1309

Gene Structure 1309 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co8406699.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 930 bp

agtgtggcagctattgtgtttggggatgggccagaaacacaactctatccattgacaaagagaagatcagaaggagccatacctatcgcagcaagttatagactgattgatgcagttttgagcaactgcattagcagcaatatacacaggatatatgctctgacacaatttaactcgacttctcttaattcccacatttccagggcttattctggactaggttttggaaatgaggggtttgttgaagtaattgcagcatatcaaagctctgataataatggatggtttcagggaactgctgatgctgttagaagatgcctatgggtgctggaagagtatccaatgtctgagtttttggtccttcctggttaccatctctacaaaatggactaccaggaactcatcaaggcccatcgaaacaataaggcagacatcacagttgccgcatcagttgctaggagaattcatgatccgggttttggctttttagatgtgaattctgaaaatcaagttctagagttcagattgaagttggagggagggccaattgataatcaatcagccaaaggctcaaggaaatccaacgatactgctctaagtagcatcacaagtatgggaatctttctcatcaacagagatgcattgaaaaggctcctagaagaacattttcccgaggcaaatgactttagaactgaagtgattcccggtgccatatccattggaatgaagattcaagcttatgcatttcatggatactgggaggacatgaggaatattgaagcattctaccaagcaaatatgcaaagtacaaagagtacagacgtgggatataagtcggtaacttttataggggaaaaggctgaatgtcctagtgttttgttcatgttggatttggaccatttttcgactaacataaactttactttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko00520 ko01100 ko01110 ko02026 map00500 map00520 map01100 map01110 map02026

Pfam Domains

Protein Families

NTP_transferase

Protein Analysis

309

Amino Acids

34.56

Weight (kDa)

5.64

Isoelectric Point (pI)

43.24

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016577)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G05610 AT1G05610
malus_domestica	MD02G1000500.v1.1 MD15G1142300.v1.1
prunus_persica	Prupe.7G270900_v2.0.a1
pyrus_communis	pycom15g12840 pycom290g00110 pycom290g00120
rosa_chinensis	RchiOBHm_Chr2g0084401
rosa_multiflora	Rmu_co8406699.1_g000001
rosa_roxburghii	Rroxscaffold_2G00156130
rosa_samantha	Rh2AG001500 Rh2CG001400
rosa_wichuraiana	Rw2G000120

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	707
AciI	CCGC	1 cut(s)	444
AclWI	GGATC	1 cut(s)	464
AcsI	RAATTY	2 cut(s)	462, 496
AcuI	CTGAAG	1 cut(s)	714
AfaI	GTAC	2 cut(s)	808, 817
AfiI	CCNNNNNNNGG	1 cut(s)	479
AgsI	TTSAA	5 cut(s)	245, 529, 646, 734, 779
AjiI	CACGTC	1 cut(s)	823
AjnI	CCWGG	3 cut(s)	200, 364, 393
AluBI	AGCT	3 cut(s)	11, 267, 737
AluI	AGCT	3 cut(s)	11, 267, 737
AlwI	GGATC	1 cut(s)	464
Ama87I	CYCGRG	1 cut(s)	671
AoxI	GGCC	3 cut(s)	29, 408, 542
ApeKI	GCWGC	4 cut(s)	8, 89, 135, 254
ApoI	RAATTY	2 cut(s)	462, 496
Asp700I	GAANNNNTTC	2 cut(s)	666, 699
AspS9I	GGNCC	5 cut(s)	29, 358, 409, 542, 895
AsuC2I	CCSGG	2 cut(s)	474, 705
AvaI	CYCGRG	1 cut(s)	671
AvaII	GGWCC	2 cut(s)	358, 895
BanI	GGYRCC	1 cut(s)	707
BarI	GAAGNNNNNNTAC	2 cut(s)	63, 95
BbvI	GCAGC	4 cut(s)	20, 101, 147, 266
BccI	CCATC	4 cut(s)	20, 276, 381, 420
BciT130I	CCWGG	3 cut(s)	202, 366, 395
BciVI	GTATCC	2 cut(s)	348, 746
BcnI	CCSGG	2 cut(s)	474, 705
BfaI	CTAG	5 cut(s)	218, 456, 515, 656, 870
BfuI	GTATCC	2 cut(s)	348, 746
BisI	GCNGC	5 cut(s)	9, 90, 136, 255, 444
BlsI	GCNGC	5 cut(s)	10, 91, 137, 256, 445
Bme1390I	CCNGG	5 cut(s)	202, 366, 395, 474, 705
Bme18I	GGWCC	2 cut(s)	358, 895
BmeT110I	CYCGRG	1 cut(s)	671
BmgBI	CACGTC	1 cut(s)	823
BmgT120I	GGNCC	5 cut(s)	29, 358, 409, 542, 895
BmiI	GGNNCC	3 cut(s)	76, 653, 709
BmrFI	CCNGG	5 cut(s)	202, 366, 395, 474, 705
BmrI	ACTGGG	1 cut(s)	766
BmsI	GCATC	6 cut(s)	100, 292, 305, 455, 612, 628
BmuI	ACTGGG	1 cut(s)	766
BpuEI	CTTGAG	1 cut(s)	556
BpuMI	CCSGG	2 cut(s)	474, 705
BsaJI	CCNNGG	2 cut(s)	201, 672
Bsc4I	CCNNNNNNNGG	1 cut(s)	479
Bse1I	ACTGG	1 cut(s)	761
BseBI	CCWGG	3 cut(s)	202, 366, 395
BseDI	CCNNGG	2 cut(s)	201, 672
BseGI	GGATG	2 cut(s)	31, 287
BseLI	CCNNNNNNNGG	1 cut(s)	479
BseMII	CTCAG	1 cut(s)	339
BseNI	ACTGG	1 cut(s)	761
BseXI	GCAGC	4 cut(s)	20, 101, 147, 266
BshFI	GGCC	3 cut(s)	31, 410, 544
BshNI	GGYRCC	1 cut(s)	707
BsiHKCI	CYCGRG	1 cut(s)	671
BsiSI	CCGG	2 cut(s)	473, 705
BslI	CCNNNNNNNGG	1 cut(s)	479
BsmI	GAATGC	1 cut(s)	782
BsnI	GGCC	3 cut(s)	31, 410, 544
BsoBI	CYCGRG	1 cut(s)	671
Bsp143I	GATC	2 cut(s)	65, 469
BspACI	CCGC	1 cut(s)	444
BspANI	GGCC	3 cut(s)	31, 410, 544
BspCNI	CTCAG	1 cut(s)	340
BspHI	TCATGA	1 cut(s)	466
BspLI	GGNNCC	3 cut(s)	76, 653, 709
BspPI	GGATC	1 cut(s)	464
BspT107I	GGYRCC	1 cut(s)	707
BsrI	ACTGG	1 cut(s)	761
BssECI	CCNNGG	2 cut(s)	201, 672
BssMI	GATC	2 cut(s)	65, 469
Bst2UI	CCWGG	3 cut(s)	202, 366, 395
Bst4CI	ACNGT	1 cut(s)	439
Bst6I	CTCTTC	1 cut(s)	327
BstAPI	GCANNNNNTGC	1 cut(s)	452
BstDEI	CTNAG	2 cut(s)	348, 596
BstEII	GGTNACC	1 cut(s)	368
BstF5I	GGATG	2 cut(s)	31, 287
BstKTI	GATC	2 cut(s)	68, 472
BstMBI	GATC	2 cut(s)	65, 469
BstMWI	GCNNNNNNNGC	2 cut(s)	135, 452
BstNI	CCWGG	3 cut(s)	202, 366, 395
BstPI	GGTNACC	1 cut(s)	368
BstSCI	CCNGG	5 cut(s)	200, 364, 393, 472, 703
BstV1I	GCAGC	4 cut(s)	20, 101, 147, 266
BsuI	GTATCC	2 cut(s)	348, 746
BsuRI	GGCC	3 cut(s)	31, 410, 544
BtrI	CACGTC	1 cut(s)	823
BtsCI	GGATG	2 cut(s)	31, 287
CciI	TCATGA	1 cut(s)	466
Cfr13I	GGNCC	5 cut(s)	29, 358, 409, 542, 895
Csp6I	GTAC	2 cut(s)	807, 816
CviAII	CATG	4 cut(s)	467, 749, 766, 883
CviQI	GTAC	2 cut(s)	807, 816
DdeI	CTNAG	2 cut(s)	348, 596
DpnI	GATC	2 cut(s)	67, 471
DpnII	GATC	2 cut(s)	65, 469
Eam1104I	CTCTTC	1 cut(s)	327
EarI	CTCTTC	1 cut(s)	327
Eco47I	GGWCC	2 cut(s)	358, 895
Eco57I	CTGAAG	1 cut(s)	714
Eco88I	CYCGRG	1 cut(s)	671
Eco91I	GGTNACC	1 cut(s)	368
EcoO65I	GGTNACC	1 cut(s)	368
EcoRI	GAATTC	2 cut(s)	462, 496
EcoRII	CCWGG	3 cut(s)	200, 364, 393
EcoT22I	ATGCAT	2 cut(s)	643, 745
FaeI	CATG	4 cut(s)	470, 752, 769, 886
FatI	CATG	4 cut(s)	466, 748, 765, 882
Fnu4HI	GCNGC	5 cut(s)	9, 90, 136, 255, 444
FokI	GGATG	2 cut(s)	38, 294
Fsp4HI	GCNGC	5 cut(s)	9, 90, 136, 255, 444
FspBI	CTAG	5 cut(s)	218, 456, 515, 656, 870
GluI	GCNGC	5 cut(s)	9, 90, 136, 255, 444
HaeIII	GGCC	3 cut(s)	31, 410, 544
HapII	CCGG	2 cut(s)	473, 705
Hin1II	CATG	4 cut(s)	470, 752, 769, 886
HindIII	AAGCTT	1 cut(s)	735
HinfI	GANTC	3 cut(s)	618, 700, 730
HpaII	CCGG	2 cut(s)	473, 705
Hpy188I	TCNGA	6 cut(s)	70, 162, 271, 349, 502, 524
Hpy188III	TCNNGA	4 cut(s)	213, 467, 515, 671
HpyAV	CCTTC	2 cut(s)	65, 371
HpyCH4III	ACNGT	1 cut(s)	439
HpyCH4IV	ACGT	1 cut(s)	822
HpyCH4V	TGCA	6 cut(s)	113, 129, 254, 641, 743, 802
HpyF10VI	GCNNNNNNNGC	2 cut(s)	135, 452
HpyF3I	CTNAG	2 cut(s)	348, 596
HpySE526I	ACGT	1 cut(s)	822
Hsp92II	CATG	4 cut(s)	470, 752, 769, 886
Kzo9I	GATC	2 cut(s)	65, 469
LmnI	GCTCC	2 cut(s)	74, 657
Lsp1109I	GCAGC	4 cut(s)	20, 101, 147, 266
LweI	GCATC	6 cut(s)	100, 292, 305, 455, 612, 628
MaeI	CTAG	5 cut(s)	218, 456, 515, 656, 870
MaeII	ACGT	1 cut(s)	822
MaeIII	GTNAC	2 cut(s)	368, 838
MalI	GATC	2 cut(s)	67, 471
MboI	GATC	2 cut(s)	65, 469
MboII	GAAGA	5 cut(s)	75, 324, 344, 671, 739
MfeI	CAATTG	1 cut(s)	546
MluCI	AATT	6 cut(s)	167, 187, 249, 462, 496, 546
MmeI	TCCRAC	3 cut(s)	513, 606, 867
MnlI	CCTC	6 cut(s)	226, 529, 533, 667, 754, 762
Mph1103I	ATGCAT	2 cut(s)	643, 745
MroXI	GAANNNNTTC	2 cut(s)	666, 699
MseI	TTAA	3 cut(s)	171, 186, 928
MslI	CAYNNNNRTG	2 cut(s)	611, 722
MspI	CCGG	2 cut(s)	473, 705
MspR9I	CCNGG	5 cut(s)	202, 366, 395, 474, 705
MunI	CAATTG	1 cut(s)	546
Mva1269I	GAATGC	1 cut(s)	782
MvaI	CCWGG	3 cut(s)	202, 366, 395
MwoI	GCNNNNNNNGC	2 cut(s)	135, 452
NciI	CCSGG	2 cut(s)	474, 705
NdeII	GATC	2 cut(s)	65, 469
NlaIII	CATG	4 cut(s)	470, 752, 769, 886
NlaIV	GGNNCC	3 cut(s)	76, 653, 709
NsiI	ATGCAT	2 cut(s)	643, 745
PagI	TCATGA	1 cut(s)	466
PctI	GAATGC	1 cut(s)	782
PdmI	GAANNNNTTC	2 cut(s)	666, 699
PfeI	GAWTC	3 cut(s)	618, 700, 730
PkrI	GCNGC	5 cut(s)	10, 91, 137, 256, 445
Psp6I	CCWGG	3 cut(s)	200, 364, 393
PspEI	GGTNACC	1 cut(s)	368
PspGI	CCWGG	3 cut(s)	200, 364, 393
PspN4I	GGNNCC	3 cut(s)	76, 653, 709
PspPI	GGNCC	5 cut(s)	29, 358, 409, 542, 895
RsaI	GTAC	2 cut(s)	808, 817
RsaNI	GTAC	2 cut(s)	807, 816
RseI	CAYNNNNRTG	2 cut(s)	611, 722
SaqAI	TTAA	3 cut(s)	171, 186, 928
SatI	GCNGC	5 cut(s)	9, 90, 136, 255, 444
Sau3AI	GATC	2 cut(s)	65, 469
Sau96I	GGNCC	5 cut(s)	29, 358, 409, 542, 895
ScrFI	CCNGG	5 cut(s)	202, 366, 395, 474, 705
SetI	ASST	6 cut(s)	13, 85, 223, 269, 739, 825
SfaNI	GCATC	6 cut(s)	100, 292, 305, 455, 612, 628
SinI	GGWCC	2 cut(s)	358, 895
SmiMI	CAYNNNNRTG	2 cut(s)	611, 722
SmlI	CTYRAG	1 cut(s)	571
SmoI	CTYRAG	1 cut(s)	571
Sse9I	AATT	6 cut(s)	167, 187, 249, 462, 496, 546
SsiI	CCGC	1 cut(s)	444
SspI	AATATT	1 cut(s)	775
SspMI	CTAG	5 cut(s)	218, 456, 515, 656, 870
StyD4I	CCNGG	5 cut(s)	200, 364, 393, 472, 703
TaaI	ACNGT	1 cut(s)	439
TaiI	ACGT	1 cut(s)	825
TaqI	TCGA	3 cut(s)	176, 415, 905
TasI	AATT	6 cut(s)	167, 187, 249, 462, 496, 546
TatI	WGTACW	2 cut(s)	806, 815
TauI	GCSGC	1 cut(s)	446
TfiI	GAWTC	3 cut(s)	618, 700, 730
Tru1I	TTAA	3 cut(s)	171, 186, 928
Tru9I	TTAA	3 cut(s)	171, 186, 928
TseI	GCWGC	4 cut(s)	8, 89, 135, 254
TspDTI	ATGAA	4 cut(s)	455, 737, 740, 871
VpaK11BI	GGWCC	2 cut(s)	358, 895
XapI	RAATTY	2 cut(s)	462, 496
XbaI	TCTAGA	1 cut(s)	514
XmnI	GAANNNNTTC	2 cut(s)	666, 699
XspI	CTAG	5 cut(s)	218, 456, 515, 656, 870
Zsp2I	ATGCAT	2 cut(s)	643, 745

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.