pycom420g00780

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
SuperScaffold_420
Physical Location & Seq
Forward (+)
953436 .. 953636
201 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom420g00780.1

Sequence Viewer

Length: 201 bp
ATGCACATGCTTGGCTCAAGAATGTATTGGTGGGTACAAGCAAGCAAGCAAGAACAGATTCATGAGCATATTGAACAATATATATTTGATTTATGCATGCATGCACAAACCAAGATCACTGCAAGAAAAAGGCCTTATTGCGACAGGTTTTTTGCGTCAGATAGCACGGCCGTCGCAAATAACACAAACTATGCACGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.93

Weight (kDa)

8.71

Isoelectric Point (pI)

74.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 168
AfaI GTAC 1 cut(s) 36
AgsI TTSAA 1 cut(s) 74
AoxI GGCC 2 cut(s) 131, 168
ArsI GACNNNNNNTTYG 2 cut(s) 134, 166
Asp700I GAANNNNTTC 1 cut(s) 57
BceAI ACGGC 2 cut(s) 155, 183
BcgI CGANNNNNNTGC 2 cut(s) 154, 188
BfaI CTAG 1 cut(s) 199
BseX3I CGGCCG 1 cut(s) 168
Bsh1285I CGRYCG 1 cut(s) 171
BshFI GGCC 2 cut(s) 133, 170
BsiEI CGRYCG 1 cut(s) 171
BsnI GGCC 2 cut(s) 133, 170
Bsp143I GATC 1 cut(s) 114
BspANI GGCC 2 cut(s) 133, 170
BspHI TCATGA 1 cut(s) 61
BssMI GATC 1 cut(s) 114
BstC8I GCNNGC 5 cut(s) 43, 47, 98, 102, 196
BstKTI GATC 1 cut(s) 117
BstMBI GATC 1 cut(s) 114
BstMCI CGRYCG 1 cut(s) 171
BstNSI RCATGY 3 cut(s) 10, 100, 104
BstZI CGGCCG 1 cut(s) 168
BsuRI GGCC 2 cut(s) 133, 170
BtsI GCAGTG 1 cut(s) 117
BtsIMutI CAGTG 1 cut(s) 117
Cac8I GCNNGC 5 cut(s) 43, 47, 98, 102, 196
CciI TCATGA 1 cut(s) 61
CseI GACGC 1 cut(s) 144
Csp6I GTAC 1 cut(s) 35
CviAII CATG 4 cut(s) 7, 62, 97, 101
CviJI RGCY 3 cut(s) 15, 133, 170
CviKI_1 RGCY 3 cut(s) 15, 133, 170
CviQI GTAC 1 cut(s) 35
DpnI GATC 1 cut(s) 116
DpnII GATC 1 cut(s) 114
EaeI YGGCCR 1 cut(s) 168
EagI CGGCCG 1 cut(s) 168
EclXI CGGCCG 1 cut(s) 168
Eco147I AGGCCT 1 cut(s) 133
Eco52I CGGCCG 1 cut(s) 168
EcoT22I ATGCAT 2 cut(s) 98, 102
FaeI CATG 4 cut(s) 10, 65, 100, 104
FaiI YATR 9 cut(s) 8, 63, 69, 81, 83, 94, 98, 102, 192
FatI CATG 4 cut(s) 6, 61, 96, 100
FspBI CTAG 1 cut(s) 199
FspEI CC 9 cut(s) 13, 16, 17, 115, 124, 130, 147, 152, 184
HaeIII GGCC 2 cut(s) 133, 170
HgaI GACGC 1 cut(s) 144
Hin1II CATG 4 cut(s) 10, 65, 100, 104
HinfI GANTC 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 160
Hpy188III TCNNGA 2 cut(s) 18, 62
Hpy99I CGWCG 1 cut(s) 176
HpyCH4V TGCA 6 cut(s) 4, 96, 100, 104, 122, 194
Hsp92II CATG 4 cut(s) 10, 65, 100, 104
Kzo9I GATC 1 cut(s) 114
LpnPI CCDG 1 cut(s) 130
MaeI CTAG 1 cut(s) 199
MalI GATC 1 cut(s) 116
MboI GATC 1 cut(s) 114
Mph1103I ATGCAT 2 cut(s) 98, 102
MroXI GAANNNNTTC 1 cut(s) 57
NdeII GATC 1 cut(s) 114
NlaIII CATG 4 cut(s) 10, 65, 100, 104
NsiI ATGCAT 2 cut(s) 98, 102
NspI RCATGY 3 cut(s) 10, 100, 104
PaeI GCATGC 2 cut(s) 100, 104
PagI TCATGA 1 cut(s) 61
PceI AGGCCT 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 58
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 114
SetI ASST 1 cut(s) 149
SmlI CTYRAG 1 cut(s) 16
SmoI CTYRAG 1 cut(s) 16
SphI GCATGC 2 cut(s) 100, 104
SseBI AGGCCT 1 cut(s) 133
SspMI CTAG 1 cut(s) 199
StuI AGGCCT 1 cut(s) 133
TfiI GAWTC 1 cut(s) 58
TscAI CASTG 1 cut(s) 124
TspDTI ATGAA 1 cut(s) 50
TspRI CASTG 1 cut(s) 124
XceI RCATGY 3 cut(s) 10, 100, 104
XmnI GAANNNNTTC 1 cut(s) 57
XspI CTAG 1 cut(s) 199
Zsp2I ATGCAT 2 cut(s) 98, 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.