RchiOBHm_Chr5g0013451

Cell division topological specificity factor homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
9064356 .. 9064832
477 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGGTGGAATCCGTCTGCTTTCTGAATGGAGGGTTAAGCATTTCTCAAATTAAACCAAAGTGGCCCAGTATGTCATTTGATAGATGTGATATTCGTCAACATTCCAAGCGATCTACTGGAGATTTTCAAATGTCACCGAATTCCATTAACCAAGATGCTGAGAGCTTCCTCATTAATGCCATCAATATGAGTTTCTTAGAACCGTTAATTCCAACTCATATCGTTCCTTTTGGAAGATAA

Protein Analysis

79

Amino Acids

8.91

Weight (kDa)

6.7

Isoelectric Point (pI)

65.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 139
AgsI TTSAA 1 cut(s) 128
AluBI AGCT 1 cut(s) 165
AluI AGCT 1 cut(s) 165
AoxI GGCC 1 cut(s) 62
ApoI RAATTY 1 cut(s) 139
AseI ATTAAT 1 cut(s) 174
AspS9I GGNCC 1 cut(s) 63
AsuHPI GGTGA 1 cut(s) 126
BccI CCATC 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 63
BmrI ACTGGG 1 cut(s) 60
BmsI GCATC 1 cut(s) 145
BmuI ACTGGG 1 cut(s) 60
BpmI CTGGAG 1 cut(s) 138
Bse1I ACTGG 2 cut(s) 66, 121
BseMII CTCAG 1 cut(s) 150
BseNI ACTGG 2 cut(s) 66, 121
BshFI GGCC 1 cut(s) 64
BsnI GGCC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 110
BspANI GGCC 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 151
BsrI ACTGG 2 cut(s) 66, 121
BssMI GATC 1 cut(s) 110
Bst4CI ACNGT 1 cut(s) 204
BstDEI CTNAG 2 cut(s) 159, 196
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BsuRI GGCC 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 63
CviJI RGCY 2 cut(s) 64, 165
CviKI_1 RGCY 2 cut(s) 64, 165
DdeI CTNAG 2 cut(s) 159, 196
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
EcoRI GAATTC 1 cut(s) 139
FaiI YATR 3 cut(s) 71, 188, 219
GsuI CTGGAG 1 cut(s) 138
HaeIII GGCC 1 cut(s) 64
HincII GTYRAC 1 cut(s) 98
HindII GTYRAC 1 cut(s) 98
HinfI GANTC 1 cut(s) 8
HphI GGTGA 1 cut(s) 126
Hpy166II GTNNAC 1 cut(s) 98
Hpy188I TCNGA 1 cut(s) 24
Hpy8I GTNNAC 1 cut(s) 98
HpyCH4III ACNGT 1 cut(s) 204
HpyF3I CTNAG 2 cut(s) 159, 196
Kzo9I GATC 1 cut(s) 110
LpnPI CCDG 2 cut(s) 79, 102
LweI GCATC 1 cut(s) 145
MaeIII GTNAC 1 cut(s) 132
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MluCI AATT 3 cut(s) 48, 139, 207
MmeI TCCRAC 1 cut(s) 236
MnlI CCTC 2 cut(s) 23, 179
MseI TTAA 5 cut(s) 35, 51, 147, 174, 206
MslI CAYNNNNRTG 1 cut(s) 185
NdeII GATC 1 cut(s) 110
NmuCI GTSAC 1 cut(s) 132
PfeI GAWTC 1 cut(s) 8
PshBI ATTAAT 1 cut(s) 174
PspPI GGNCC 1 cut(s) 63
RseI CAYNNNNRTG 1 cut(s) 185
SaqAI TTAA 5 cut(s) 35, 51, 147, 174, 206
Sau3AI GATC 1 cut(s) 110
Sau96I GGNCC 1 cut(s) 63
SetI ASST 1 cut(s) 167
SfaNI GCATC 1 cut(s) 145
SgeI CNNG 4 cut(s) 78, 118, 129, 164
SmiMI CAYNNNNRTG 1 cut(s) 185
Sse9I AATT 3 cut(s) 48, 139, 207
TaaI ACNGT 1 cut(s) 204
TasI AATT 3 cut(s) 48, 139, 207
TfiI GAWTC 1 cut(s) 8
Tru1I TTAA 5 cut(s) 35, 51, 147, 174, 206
Tru9I TTAA 5 cut(s) 35, 51, 147, 174, 206
TseFI GTSAC 1 cut(s) 132
Tsp45I GTSAC 1 cut(s) 132
VspI ATTAAT 1 cut(s) 174
XapI RAATTY 1 cut(s) 139
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.