RchiOBHm_Chr5g0018941

cellular macromolecule catabolic process

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
13414299 .. 13415094
796 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGGGTATGGTGGTGGTGATCTCTCTGCCTTTTATTCTGTTCACCATACTGCTTGGTTTCGGGTGTTACTTCTTTGGAAGAGCGAGAGGCCGAAAGGAGGCGATGACAAGTCCTCAAGTTTATGGGGTGCCAACTCCACCACCAGGAGCTAATAGCACTTCACACCCTTCATCTCCTCAGCCACATCCTTATTTCAAACCAGACAACTCTGCCAATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

7.88

Weight (kDa)

9.51

Isoelectric Point (pI)

42.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017169)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 127
AfiI CCNNNNNNNGG 2 cut(s) 97, 143
AgsI TTSAA 1 cut(s) 196
AjnI CCWGG 1 cut(s) 142
AluBI AGCT 1 cut(s) 149
AluI AGCT 1 cut(s) 149
AoxI GGCC 1 cut(s) 88
AsuHPI GGTGA 2 cut(s) 28, 34
BanI GGYRCC 1 cut(s) 127
BbvCI CCTCAGC 1 cut(s) 177
BciT130I CCWGG 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 144
BmiI GGNNCC 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 144
Bpu10I CCTNAGC 1 cut(s) 177
BpuEI CTTGAG 1 cut(s) 99
Bsc4I CCNNNNNNNGG 2 cut(s) 97, 143
BseBI CCWGG 1 cut(s) 144
BseGI GGATG 1 cut(s) 184
BseLI CCNNNNNNNGG 2 cut(s) 97, 143
BseMII CTCAG 1 cut(s) 191
BseRI GAGGAG 1 cut(s) 165
BshFI GGCC 1 cut(s) 90
BshNI GGYRCC 1 cut(s) 127
BslI CCNNNNNNNGG 2 cut(s) 97, 143
BsnI GGCC 1 cut(s) 90
Bsp143I GATC 1 cut(s) 18
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 190
BspLI GGNNCC 1 cut(s) 129
BspQI GCTCTTC 1 cut(s) 73
BspT107I GGYRCC 1 cut(s) 127
BssMI GATC 1 cut(s) 18
Bst2UI CCWGG 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 73
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 1 cut(s) 184
BstKTI GATC 1 cut(s) 21
BstMBI GATC 1 cut(s) 18
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BsuRI GGCC 1 cut(s) 90
BtgZI GCGATG 1 cut(s) 116
BtsCI GGATG 1 cut(s) 184
CviJI RGCY 3 cut(s) 90, 149, 181
CviKI_1 RGCY 3 cut(s) 90, 149, 181
DdeI CTNAG 1 cut(s) 177
DpnI GATC 1 cut(s) 20
DpnII GATC 1 cut(s) 18
Eam1104I CTCTTC 1 cut(s) 73
EarI CTCTTC 1 cut(s) 73
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 3 cut(s) 8, 47, 123
FokI GGATG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 90
HphI GGTGA 2 cut(s) 28, 34
Hpy166II GTNNAC 1 cut(s) 42
Hpy8I GTNNAC 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 177
HpyF3I CTNAG 1 cut(s) 177
Kzo9I GATC 1 cut(s) 18
LguI GCTCTTC 1 cut(s) 73
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 3 cut(s) 129, 156, 213
MaeIII GTNAC 1 cut(s) 65
MalI GATC 1 cut(s) 20
MboI GATC 1 cut(s) 18
MboII GAAGA 1 cut(s) 90
MnlI CCTC 4 cut(s) 80, 91, 123, 186
MseI TTAA 1 cut(s) 220
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
NdeII GATC 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 129
PciSI GCTCTTC 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
PspN4I GGNNCC 1 cut(s) 129
SapI GCTCTTC 1 cut(s) 73
SaqAI TTAA 1 cut(s) 220
Sau3AI GATC 1 cut(s) 18
ScrFI CCNGG 1 cut(s) 144
SetI ASST 1 cut(s) 151
SgeI CNNG 8 cut(s) 65, 73, 96, 120, 128, 155, 156, 212
SmlI CTYRAG 1 cut(s) 114
SmoI CTYRAG 1 cut(s) 114
StyD4I CCNGG 1 cut(s) 142
Tru1I TTAA 1 cut(s) 220
Tru9I TTAA 1 cut(s) 220
TspDTI ATGAA 1 cut(s) 159
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.