RchiOBHm_Chr5g0081311

Protein of unknown function (DUF740)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
87297249 .. 87298380
1132 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGGTTTCTGAGATGCTTATCATCTTGGCTACCAGAAAAGTCCACCGTAGAAGCACCCAAAGCTTCAGTTACAGAAAGCCACCCATTACTCTTCCAAAGATCTTTGCTTTCAACTCTTTCCTCAATCGGAGGCCACTTTGCTTGGATCAAGAAGCTTCGACCAGCCAAGAAGGTAGACAGAACTCTCCAGAAACCTTGATATTTAGGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

8.2

Weight (kDa)

10.84

Isoelectric Point (pI)

68.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 175
AclWI GGATC 1 cut(s) 153
AcuI CTGAAG 1 cut(s) 49
AgsI TTSAA 1 cut(s) 112
AluBI AGCT 2 cut(s) 63, 155
AluI AGCT 2 cut(s) 63, 155
AlwI GGATC 1 cut(s) 153
AoxI GGCC 1 cut(s) 131
BglII AGATCT 1 cut(s) 99
BmsI GCATC 1 cut(s) 3
BpmI CTGGAG 1 cut(s) 171
BsaBI GATNNNNATC 1 cut(s) 17
Bse8I GATNNNNATC 1 cut(s) 17
BseJI GATNNNNATC 1 cut(s) 17
BshFI GGCC 1 cut(s) 133
BsnI GGCC 1 cut(s) 133
Bsp143I GATC 2 cut(s) 99, 145
BspANI GGCC 1 cut(s) 133
BspPI GGATC 1 cut(s) 153
BssMI GATC 2 cut(s) 99, 145
Bst4CI ACNGT 1 cut(s) 47
Bst6I CTCTTC 1 cut(s) 96
BstDEI CTNAG 1 cut(s) 9
BstKTI GATC 2 cut(s) 102, 148
BstMBI GATC 2 cut(s) 99, 145
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
BsuRI GGCC 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 123, 158
CviJI RGCY 6 cut(s) 29, 63, 79, 133, 155, 165
CviKI_1 RGCY 6 cut(s) 29, 63, 79, 133, 155, 165
DdeI CTNAG 1 cut(s) 9
DpnI GATC 2 cut(s) 101, 147
DpnII GATC 2 cut(s) 99, 145
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 49
FblI GTMKAC 1 cut(s) 175
GsuI CTGGAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 133
HindIII AAGCTT 2 cut(s) 61, 153
Hpy166II GTNNAC 2 cut(s) 43, 176
Hpy188I TCNGA 2 cut(s) 10, 129
Hpy188III TCNNGA 2 cut(s) 149, 188
Hpy8I GTNNAC 2 cut(s) 43, 176
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
HpyF3I CTNAG 1 cut(s) 9
Kzo9I GATC 2 cut(s) 99, 145
LpnPI CCDG 3 cut(s) 46, 175, 201
LweI GCATC 1 cut(s) 3
MaeIII GTNAC 1 cut(s) 68
MalI GATC 2 cut(s) 101, 147
MboI GATC 2 cut(s) 99, 145
MboII GAAGA 1 cut(s) 83
MflI RGATCY 1 cut(s) 99
MnlI CCTC 2 cut(s) 123, 131
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 2 cut(s) 99, 145
PsuI RGATCY 1 cut(s) 99
Sau3AI GATC 2 cut(s) 99, 145
SetI ASST 5 cut(s) 65, 157, 175, 197, 209
SfaNI GCATC 1 cut(s) 3
SgeI CNNG 8 cut(s) 37, 45, 154, 161, 174, 179, 200, 208
TaaI ACNGT 1 cut(s) 47
TaqI TCGA 1 cut(s) 158
XmiI GTMKAC 1 cut(s) 175
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.