RchiOBHm_Chr5g0007251

Protein of unknown function (DUF740)

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
4570489 .. 4573199
2711 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28832

Sequence Viewer

Length: 219 bp
ATGGTTTCTGAGATGCTTATCATCTTGGCTACCAGAAAAGTCCACCGTAGAAGCACCCAAAGCTTCAGTTACAGAAAGCCACCCATTACTCTTCCAAAGATCTTTGCTTTCAACTCTTTCCTCAATCGGAGGCCACTTTGCTTGGATCAAGAAGCTTCGACCAGCCAAGAAGGTAACTTTTTTCATCTGGATTGTGGTAAAGTTTTGATCTTTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.38

Weight (kDa)

9.89

Isoelectric Point (pI)

49.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 153
AcuI CTGAAG 1 cut(s) 49
AgsI TTSAA 1 cut(s) 112
AluBI AGCT 2 cut(s) 63, 155
AluI AGCT 2 cut(s) 63, 155
AlwI GGATC 1 cut(s) 153
AoxI GGCC 1 cut(s) 131
BglII AGATCT 1 cut(s) 99
BmsI GCATC 1 cut(s) 3
BsaBI GATNNNNATC 1 cut(s) 17
Bse8I GATNNNNATC 1 cut(s) 17
BseJI GATNNNNATC 1 cut(s) 17
BshFI GGCC 1 cut(s) 133
BsnI GGCC 1 cut(s) 133
Bsp143I GATC 3 cut(s) 99, 145, 207
BspANI GGCC 1 cut(s) 133
BspPI GGATC 1 cut(s) 153
BssMI GATC 3 cut(s) 99, 145, 207
Bst4CI ACNGT 1 cut(s) 47
Bst6I CTCTTC 1 cut(s) 96
BstDEI CTNAG 1 cut(s) 9
BstKTI GATC 3 cut(s) 102, 148, 210
BstMBI GATC 3 cut(s) 99, 145, 207
BstMWI GCNNNNNNNGC 1 cut(s) 60
BstX2I RGATCY 1 cut(s) 99
BstYI RGATCY 1 cut(s) 99
BsuRI GGCC 1 cut(s) 133
CspCI CAANNNNNGTGG 2 cut(s) 123, 158
CviJI RGCY 6 cut(s) 29, 63, 79, 133, 155, 165
CviKI_1 RGCY 6 cut(s) 29, 63, 79, 133, 155, 165
DdeI CTNAG 1 cut(s) 9
DpnI GATC 3 cut(s) 101, 147, 209
DpnII GATC 3 cut(s) 99, 145, 207
Eam1104I CTCTTC 1 cut(s) 96
EarI CTCTTC 1 cut(s) 96
Eco57I CTGAAG 1 cut(s) 49
FaiI YATR 1 cut(s) 215
HaeIII GGCC 1 cut(s) 133
HindIII AAGCTT 2 cut(s) 61, 153
Hpy166II GTNNAC 1 cut(s) 43
Hpy188I TCNGA 2 cut(s) 10, 129
Hpy188III TCNNGA 2 cut(s) 149, 188
Hpy8I GTNNAC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 164
HpyCH4III ACNGT 1 cut(s) 47
HpyF10VI GCNNNNNNNGC 1 cut(s) 60
HpyF3I CTNAG 1 cut(s) 9
Kzo9I GATC 3 cut(s) 99, 145, 207
LpnPI CCDG 3 cut(s) 46, 173, 175
LweI GCATC 1 cut(s) 3
MaeIII GTNAC 2 cut(s) 68, 173
MalI GATC 3 cut(s) 101, 147, 209
MboI GATC 3 cut(s) 99, 145, 207
MboII GAAGA 1 cut(s) 83
MflI RGATCY 1 cut(s) 99
MnlI CCTC 2 cut(s) 123, 131
MwoI GCNNNNNNNGC 1 cut(s) 60
NdeII GATC 3 cut(s) 99, 145, 207
PsuI RGATCY 1 cut(s) 99
Sau3AI GATC 3 cut(s) 99, 145, 207
SetI ASST 3 cut(s) 65, 157, 175
SfaNI GCATC 1 cut(s) 3
SgeI CNNG 7 cut(s) 37, 45, 154, 161, 174, 179, 200
TaaI ACNGT 1 cut(s) 47
TaqI TCGA 1 cut(s) 158
TspDTI ATGAA 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.