Rroxscaffold_4G00312480

Zinc finger, C3HC4 type (RING finger)

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
Physical Location & Seq
Reverse (-)
35474093 .. 35477922
3830 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00312480.1

Sequence Viewer

Length: 159 bp
ATGAAGAAGAGTGAGAACGAGAAGATAGACCCTGAAATTGTTGTTGTGAATGTAGAAAAGAAAACAGGAGAAGATGAGAAGAAGGGTGAATGGTCTGGTGCTTCGTGCTCAAGCTCATATCTTCCTTGCATGGATAAGCTCAGGGATCAGCTTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.85

Weight (kDa)

4.99

Isoelectric Point (pI)

32.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 153
AluBI AGCT 3 cut(s) 114, 139, 151
AluI AGCT 3 cut(s) 114, 139, 151
Alw21I GWGCWC 1 cut(s) 110
AlwI GGATC 1 cut(s) 153
AsuHPI GGTGA 1 cut(s) 98
Bbv12I GWGCWC 1 cut(s) 110
Bpu10I CCTNAGC 1 cut(s) 140
BpuEI CTTGAG 1 cut(s) 94
BseMII CTCAG 1 cut(s) 154
BsiHKAI GWGCWC 1 cut(s) 110
Bsp1286I GDGCHC 1 cut(s) 110
Bsp143I GATC 1 cut(s) 145
BspCNI CTCAG 1 cut(s) 153
BspPI GGATC 1 cut(s) 153
BssMI GATC 1 cut(s) 145
Bst6I CTCTTC 1 cut(s) 2
BstDEI CTNAG 1 cut(s) 140
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
CviAII CATG 1 cut(s) 130
CviJI RGCY 3 cut(s) 114, 139, 151
CviKI_1 RGCY 3 cut(s) 114, 139, 151
DdeI CTNAG 1 cut(s) 140
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
Eam1104I CTCTTC 1 cut(s) 2
EarI CTCTTC 1 cut(s) 2
FaeI CATG 1 cut(s) 133
FaiI YATR 2 cut(s) 118, 131
FatI CATG 1 cut(s) 129
Hin1II CATG 1 cut(s) 133
HphI GGTGA 1 cut(s) 98
Hpy188III TCNNGA 1 cut(s) 156
HpyAV CCTTC 1 cut(s) 76
HpyCH4V TGCA 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 140
Hsp92II CATG 1 cut(s) 133
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 4 cut(s) 45, 51, 81, 127
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 6 cut(s) 16, 19, 34, 83, 91, 113
MhlI GDGCHC 1 cut(s) 110
MluCI AATT 1 cut(s) 36
NdeII GATC 1 cut(s) 145
NlaIII CATG 1 cut(s) 133
Sau3AI GATC 1 cut(s) 145
SduI GDGCHC 1 cut(s) 110
SetI ASST 3 cut(s) 116, 141, 153
SgeI CNNG 9 cut(s) 31, 44, 78, 108, 117, 123, 138, 142, 154
SmlI CTYRAG 1 cut(s) 109
SmoI CTYRAG 1 cut(s) 109
Sse9I AATT 1 cut(s) 36
TasI AATT 1 cut(s) 36
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.