RchiOBHm_Chr4g0442351

At4g28440-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
63975553 .. 63978789
3237 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 684 bp
ATGTCGGATGTCACTCTCACTGTAAAGGTTGTTAGTACTACGATAGTAGGTCGGAAGGGACGTCCTGGTGGCCCTCGAAGCCACATGCAATTTGCTGACTGCTTGGTTGGCGATGAAACTGGAGTGATAATCTTCAGAGCTACAAACGATCAAGTGGACTTGATGAAAGTGGGTTTGACTGTAACTCTGCAAAATGCCAAAGTTGACATGTTCAAAGATTCAATGAGGCTTGTTGTCGACAAAAGTGGCAGTGTTCTAGTTGCTGAGCCGGCCAGTTTTACTGTGAAGGAAGATAGCAACCTCTCACTCATTCAAGCATCGATTGGAAATGTCAACAAAGATAATGCCATAAAGGTTGAAAAGCTCCGCCCAGACATGTCGGATGTCACTCTCACTGTAAAGGTTGTTAGTACTAAGATAGTAGGTATTCAATTTGCTGAGTGCTTGGTTGGCGATGAAACTGGAATGATAGTCTTCAGAGCTACAAACGATCAAGTGGACTTGATGAAAGAGGGTTTGACTGTAACTCTGCAAAATGCCAAAGTTGACATGTCCGAAGATTCAATGAGGCTTGTTGTCGACGAAAGTGGCAGTGTTGAAGTTGCTGAGCCTGCCGGTTTTACTGTGAAGGAAGATAACAACCTCTCACTCATTGAATTTGAACGTGTCGATGTCGATATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

227

Amino Acids

24.59

Weight (kDa)

4.63

Isoelectric Point (pI)

19.2

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 3 - 85 1.2e-29 Single-stranded DNA binding protein Ssb-like, OB fold
OB_Ssb-like PF21473 122 - 201 1.5e-24 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018178)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 64
AccI GTMKAC 2 cut(s) 237, 579
AciI CCGC 1 cut(s) 367
AcoI YGGCCR 1 cut(s) 270
AcsI RAATTY 1 cut(s) 656
AcuI CTGAAG 2 cut(s) 118, 460
AcyI GRCGYC 1 cut(s) 61
AfaI GTAC 2 cut(s) 37, 412
AflIII ACRYGT 4 cut(s) 207, 375, 549, 664
AgsI TTSAA 9 cut(s) 214, 222, 314, 359, 431, 564, 599, 656, 662
AjnI CCWGG 1 cut(s) 64
AluBI AGCT 3 cut(s) 140, 364, 482
AluI AGCT 3 cut(s) 140, 364, 482
AoxI GGCC 2 cut(s) 70, 270
ApoI RAATTY 1 cut(s) 656
AspS9I GGNCC 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 466
BciT130I CCWGG 1 cut(s) 66
BfaI CTAG 1 cut(s) 257
BlpI GCTNAGC 2 cut(s) 264, 606
BmcAI AGTACT 2 cut(s) 37, 412
Bme1390I CCNGG 1 cut(s) 66
BmgT120I GGNCC 1 cut(s) 71
BmrFI CCNGG 1 cut(s) 66
BmsI GCATC 1 cut(s) 326
BpiI GAAGAC 1 cut(s) 466
BpmI CTGGAG 1 cut(s) 141
Bpu1102I GCTNAGC 2 cut(s) 264, 606
Bsa29I ATCGAT 1 cut(s) 320
BsaHI GRCGYC 1 cut(s) 61
Bse118I RCCGGY 2 cut(s) 268, 614
Bse1I ACTGG 3 cut(s) 124, 273, 466
BseBI CCWGG 1 cut(s) 66
BseCI ATCGAT 1 cut(s) 320
BseGI GGATG 2 cut(s) 13, 388
BseMII CTCAG 3 cut(s) 255, 429, 597
BseNI ACTGG 3 cut(s) 124, 273, 466
BshFI GGCC 2 cut(s) 72, 272
BshVI ATCGAT 1 cut(s) 320
BsiSI CCGG 2 cut(s) 269, 615
BslFI GGGAC 1 cut(s) 72
BsmFI GGGAC 1 cut(s) 72
BsnI GGCC 2 cut(s) 72, 272
Bsp143I GATC 2 cut(s) 148, 490
Bsp1720I GCTNAGC 2 cut(s) 264, 606
BspACI CCGC 1 cut(s) 367
BspANI GGCC 2 cut(s) 72, 272
BspCNI CTCAG 3 cut(s) 256, 430, 598
BspDI ATCGAT 1 cut(s) 320
BsrFI RCCGGY 2 cut(s) 268, 614
BsrI ACTGG 3 cut(s) 124, 273, 466
BssAI RCCGGY 2 cut(s) 268, 614
BssMI GATC 2 cut(s) 148, 490
BssNI GRCGYC 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 66
Bst4CI ACNGT 6 cut(s) 22, 181, 283, 397, 523, 625
BstACI GRCGYC 1 cut(s) 61
BstC8I GCNNGC 2 cut(s) 270, 612
BstDEI CTNAG 4 cut(s) 264, 414, 438, 606
BstF5I GGATG 2 cut(s) 13, 388
BstKTI GATC 2 cut(s) 151, 493
BstMBI GATC 2 cut(s) 148, 490
BstMWI GCNNNNNNNGC 5 cut(s) 78, 108, 269, 450, 611
BstNI CCWGG 1 cut(s) 66
BstNSI RCATGY 4 cut(s) 88, 211, 379, 553
BstSCI CCNGG 1 cut(s) 64
BstV2I GAAGAC 1 cut(s) 466
Bsu15I ATCGAT 1 cut(s) 320
BsuRI GGCC 2 cut(s) 72, 272
BsuTUI ATCGAT 1 cut(s) 320
BtgZI GCGATG 2 cut(s) 126, 468
BtsCI GGATG 2 cut(s) 13, 388
BtsI GCAGTG 2 cut(s) 256, 598
BtsIMutI CAGTG 4 cut(s) 18, 256, 393, 598
Cac8I GCNNGC 2 cut(s) 270, 612
Cfr10I RCCGGY 2 cut(s) 268, 614
Cfr13I GGNCC 1 cut(s) 71
ClaI ATCGAT 1 cut(s) 320
Csp6I GTAC 2 cut(s) 36, 411
CviAII CATG 4 cut(s) 85, 208, 376, 550
CviQI GTAC 2 cut(s) 36, 411
DdeI CTNAG 4 cut(s) 264, 414, 438, 606
DpnI GATC 2 cut(s) 150, 492
DpnII GATC 2 cut(s) 148, 490
EaeI YGGCCR 1 cut(s) 270
EciI GGCGGA 1 cut(s) 356
Eco57I CTGAAG 2 cut(s) 118, 460
EcoRII CCWGG 1 cut(s) 64
FaeI CATG 4 cut(s) 88, 211, 379, 553
FaiI YATR 7 cut(s) 86, 209, 350, 377, 551, 680, 682
FaqI GGGAC 1 cut(s) 72
FatI CATG 4 cut(s) 84, 207, 375, 549
FblI GTMKAC 2 cut(s) 237, 579
FokI GGATG 2 cut(s) 20, 395
FspBI CTAG 1 cut(s) 257
GsuI CTGGAG 1 cut(s) 141
HaeIII GGCC 2 cut(s) 72, 272
HapII CCGG 2 cut(s) 269, 615
Hin1I GRCGYC 1 cut(s) 61
Hin1II CATG 4 cut(s) 88, 211, 379, 553
HincII GTYRAC 5 cut(s) 205, 238, 334, 547, 580
HindII GTYRAC 5 cut(s) 205, 238, 334, 547, 580
HinfI GANTC 2 cut(s) 218, 560
HpaII CCGG 2 cut(s) 269, 615
Hpy166II GTNNAC 7 cut(s) 157, 205, 238, 334, 499, 547, 580
Hpy188I TCNGA 6 cut(s) 7, 54, 137, 382, 479, 556
Hpy8I GTNNAC 7 cut(s) 157, 205, 238, 334, 499, 547, 580
Hpy99I CGWCG 1 cut(s) 584
HpyAV CCTTC 3 cut(s) 49, 280, 622
HpyCH4III ACNGT 6 cut(s) 22, 181, 283, 397, 523, 625
HpyCH4IV ACGT 2 cut(s) 61, 664
HpyCH4V TGCA 3 cut(s) 88, 190, 532
HpyF10VI GCNNNNNNNGC 5 cut(s) 78, 108, 269, 450, 611
HpyF3I CTNAG 4 cut(s) 264, 414, 438, 606
HpySE526I ACGT 2 cut(s) 61, 664
Hsp92I GRCGYC 1 cut(s) 61
Hsp92II CATG 4 cut(s) 88, 211, 379, 553
KroI GCCGGC 1 cut(s) 268
KroNI GCCGGC 1 cut(s) 270
Kzo9I GATC 2 cut(s) 148, 490
LmnI GCTCC 1 cut(s) 369
LpnPI CCDG 9 cut(s) 51, 78, 105, 282, 286, 384, 447, 624, 628
LweI GCATC 1 cut(s) 326
MaeI CTAG 1 cut(s) 257
MaeII ACGT 2 cut(s) 61, 664
MaeIII GTNAC 4 cut(s) 10, 181, 385, 523
MalI GATC 2 cut(s) 150, 492
MboI GATC 2 cut(s) 148, 490
MboII GAAGA 5 cut(s) 124, 302, 466, 569, 644
MluCI AATT 3 cut(s) 89, 431, 656
MmeI TCCRAC 2 cut(s) 32, 360
MnlI CCTC 6 cut(s) 84, 219, 311, 505, 561, 653
MroNI GCCGGC 1 cut(s) 268
MspI CCGG 2 cut(s) 269, 615
MspR9I CCNGG 1 cut(s) 66
MvaI CCWGG 1 cut(s) 66
MwoI GCNNNNNNNGC 5 cut(s) 78, 108, 269, 450, 611
NaeI GCCGGC 1 cut(s) 270
NdeII GATC 2 cut(s) 148, 490
NgoMIV GCCGGC 1 cut(s) 268
NlaIII CATG 4 cut(s) 88, 211, 379, 553
NmuCI GTSAC 2 cut(s) 10, 385
NspI RCATGY 4 cut(s) 88, 211, 379, 553
PciI ACATGT 3 cut(s) 207, 375, 549
PcsI WCGNNNNNNNCGW 1 cut(s) 58
PdiI GCCGGC 1 cut(s) 270
PfeI GAWTC 2 cut(s) 218, 560
PscI ACATGT 3 cut(s) 207, 375, 549
Psp6I CCWGG 1 cut(s) 64
PspGI CCWGG 1 cut(s) 64
PspPI GGNCC 1 cut(s) 71
RsaI GTAC 2 cut(s) 37, 412
RsaNI GTAC 2 cut(s) 36, 411
SalI GTCGAC 2 cut(s) 236, 578
Sau3AI GATC 2 cut(s) 148, 490
Sau96I GGNCC 1 cut(s) 71
ScaI AGTACT 2 cut(s) 37, 412
ScrFI CCNGG 1 cut(s) 66
SfaNI GCATC 1 cut(s) 326
Sse9I AATT 3 cut(s) 89, 431, 656
SsiI CCGC 1 cut(s) 367
SspMI CTAG 1 cut(s) 257
StyD4I CCNGG 1 cut(s) 64
TaaI ACNGT 6 cut(s) 22, 181, 283, 397, 523, 625
TaiI ACGT 2 cut(s) 64, 667
TaqI TCGA 6 cut(s) 76, 237, 320, 579, 669, 675
TasI AATT 3 cut(s) 89, 431, 656
TatI WGTACW 2 cut(s) 35, 410
TfiI GAWTC 2 cut(s) 218, 560
TscAI CASTG 4 cut(s) 25, 256, 400, 598
TseFI GTSAC 2 cut(s) 10, 385
Tsp45I GTSAC 2 cut(s) 10, 385
TspDTI ATGAA 4 cut(s) 129, 179, 471, 521
TspRI CASTG 4 cut(s) 25, 256, 400, 598
XapI RAATTY 1 cut(s) 656
XceI RCATGY 4 cut(s) 88, 211, 379, 553
XmiI GTMKAC 2 cut(s) 237, 579
XspI CTAG 1 cut(s) 257
ZraI GACGTC 1 cut(s) 62
ZrmI AGTACT 2 cut(s) 37, 412
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.