Rh4BG405700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4B
OG0018178
Physical Location & Seq
Reverse (-)
55580972 .. 55583232
2261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4BG405700.1

Sequence Viewer

Length: 981 bp
ATGGCGAAGCAGCCACCCATAGGGCCACCAAAGCGTCCGGACCAGGCCCAGAACAAGAAGGGCCATTCTTCCGATTGGGTCTCCGGGACAGATCCCTCAGACGCGTCGCGAAGATGGATGGGAGTAGGCCCATTCGATGTTTGCTCCTACATCAGCCAAATCCCAAGCGGGGGGAGCTTCTTCACCAACCAGGTCCAACTTCATGATCCGCGAAACGACGACCAGATTGGAAATGCTCATGGCGGTGTTGCTGCTACAAACCCAATTCAAGCATCGTTTGGAAATGTCAACAAAGATAATGCCACAAAGGTTGAAAAGCTCCGCCCAGACATGTCGGATGTCACTCTCACTGTAAAGGTTGTTAGTACTAAGATAGTAGGTATGCAATTTGCTGACTGCTTGGTTGGCGATGAAACTGGAGTGATAATCTTCAGAGCTACTAACGATCAAGTGGAATTGATGAAAGAGGGTTTGACTGTAACTCTGCAAAATGCCAAAGTTGACATGTTCAATGATTCAATGAGGCTTGTTGTCGACGAAAGTGGCAGTGTTCAAGTTGCTGAGCCTGCCGGTTTTACTGTGAAGGAAGATAGCAACCTCTCACTCATTCATGCATCATTTGGAAATGTCTACAAAGACAATGCCATAAAGGTTGAAAAGCTCCGCCCAGACATGTCGGATGTCACTCTCACTGTAAAGGTTGTTAGTACTAAGATAGTAGGTATGCAATTTGCTGACTGCTTGGTTGGCGATGAAACTGGAATGATAGTCTTCAGAGCTACAAACGATCAAGTGGACTTGATGAAAGAGGGTTTGACTGTAACTCTGCAAAATGCCAAAGTTGACATGTTCGAAGATTCAATGAGGCTTGTTGTCGACGAAAGTGGCAGTGTTGAAGTTGCTGAGCCTGCCGGTTTTACTGTGAAGGAAGATAACAACCTCTCACTCATTGAATTTGAATGTGTCCAGGTTTATACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03030 ko03420 ko03430 ko03440 ko03460 map03030 map03420 map03430 map03440 map03460
Pfam Domains
Protein Families
No domains found.

Protein Analysis

326

Amino Acids

35.42

Weight (kDa)

4.66

Isoelectric Point (pI)

25.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
OB_Ssb-like PF21473 107 - 186 5.8e-25 Single-stranded DNA binding protein Ssb-like, OB fold
OB_Ssb-like PF21473 221 - 300 2.6e-25 Single-stranded DNA binding protein Ssb-like, OB fold
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018178)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0442351 RchiOBHm_Chr7g0219251
rosa_laevigata RLG00000006016
rosa_multiflora Rmu_co8418355.1_g000001 Rmu_sc0000124.1_g000049
rosa_roxburghii Rroxscaffold_5G00383220
rosa_rugosa Rorug04G0340500
rosa_samantha Rh4AG392200 Rh4BG405700 Rh4CG420800 Rh4DG398900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 3 cut(s) 534, 630, 876
AccII CGCG 3 cut(s) 104, 109, 211
AccIII TCCGGA 1 cut(s) 37
AciI CCGC 5 cut(s) 168, 209, 243, 322, 664
AclWI GGATC 2 cut(s) 86, 200
AcsI RAATTY 1 cut(s) 953
AcuI CTGAAG 2 cut(s) 415, 757
AfaI GTAC 2 cut(s) 367, 709
AfiI CCNNNNNNNGG 3 cut(s) 20, 169, 170
AflIII ACRYGT 5 cut(s) 102, 330, 504, 672, 846
AjnI CCWGG 3 cut(s) 42, 189, 966
AluBI AGCT 5 cut(s) 177, 319, 437, 661, 779
AluI AGCT 5 cut(s) 177, 319, 437, 661, 779
Alw26I GTCTC 1 cut(s) 85
AlwI GGATC 2 cut(s) 86, 200
Aor13HI TCCGGA 1 cut(s) 37
AoxI GGCC 4 cut(s) 23, 45, 61, 127
ApeKI GCWGC 2 cut(s) 10, 251
ApoI RAATTY 1 cut(s) 953
AspS9I GGNCC 6 cut(s) 23, 40, 46, 61, 128, 193
AsuC2I CCSGG 1 cut(s) 85
AsuHPI GGTGA 1 cut(s) 175
AsuII TTCGAA 1 cut(s) 852
AvaII GGWCC 2 cut(s) 40, 193
BbsI GAAGAC 1 cut(s) 763
BbvI GCAGC 2 cut(s) 22, 238
BccI CCATC 2 cut(s) 108, 112
BciT130I CCWGG 3 cut(s) 44, 191, 968
BcnI CCSGG 1 cut(s) 85
BcoDI GTCTC 1 cut(s) 85
BisI GCNGC 2 cut(s) 11, 252
BlpI GCTNAGC 2 cut(s) 561, 903
BlsI GCNGC 2 cut(s) 12, 253
BmcAI AGTACT 2 cut(s) 367, 709
Bme1390I CCNGG 4 cut(s) 44, 85, 191, 968
Bme18I GGWCC 2 cut(s) 40, 193
BmgT120I GGNCC 6 cut(s) 23, 40, 46, 61, 128, 193
BmrFI CCNGG 4 cut(s) 44, 85, 191, 968
BmsI GCATC 2 cut(s) 281, 623
BpiI GAAGAC 1 cut(s) 763
BpmI CTGGAG 1 cut(s) 438
Bpu1102I GCTNAGC 2 cut(s) 561, 903
Bpu14I TTCGAA 1 cut(s) 852
BpuMI CCSGG 1 cut(s) 85
BsaI GGTCTC 1 cut(s) 85
BsaWI WCCGGW 1 cut(s) 37
Bsc4I CCNNNNNNNGG 3 cut(s) 20, 169, 170
Bse118I RCCGGY 2 cut(s) 569, 911
Bse1I ACTGG 2 cut(s) 421, 763
BseAI TCCGGA 1 cut(s) 37
BseBI CCWGG 3 cut(s) 44, 191, 968
BseGI GGATG 3 cut(s) 123, 343, 685
BseLI CCNNNNNNNGG 3 cut(s) 20, 169, 170
BseMII CTCAG 3 cut(s) 111, 552, 894
BseNI ACTGG 2 cut(s) 421, 763
BseXI GCAGC 2 cut(s) 22, 238
Bsh1236I CGCG 3 cut(s) 104, 109, 211
BshFI GGCC 4 cut(s) 25, 47, 63, 129
BsiSI CCGG 4 cut(s) 38, 84, 570, 912
BslFI GGGAC 1 cut(s) 100
BslI CCNNNNNNNGG 3 cut(s) 20, 169, 170
BsmAI GTCTC 1 cut(s) 85
BsmFI GGGAC 1 cut(s) 100
BsnI GGCC 4 cut(s) 25, 47, 63, 129
Bso31I GGTCTC 1 cut(s) 85
Bsp119I TTCGAA 1 cut(s) 852
Bsp13I TCCGGA 1 cut(s) 37
Bsp143I GATC 4 cut(s) 91, 205, 445, 787
Bsp1720I GCTNAGC 2 cut(s) 561, 903
Bsp68I TCGCGA 1 cut(s) 109
BspACI CCGC 5 cut(s) 168, 209, 243, 322, 664
BspANI GGCC 4 cut(s) 25, 47, 63, 129
BspCNI CTCAG 3 cut(s) 110, 553, 895
BspEI TCCGGA 1 cut(s) 37
BspFNI CGCG 3 cut(s) 104, 109, 211
BspHI TCATGA 1 cut(s) 202
BspPI GGATC 2 cut(s) 86, 200
BspT104I TTCGAA 1 cut(s) 852
BspTNI GGTCTC 1 cut(s) 85
BsrFI RCCGGY 2 cut(s) 569, 911
BsrI ACTGG 2 cut(s) 421, 763
BssAI RCCGGY 2 cut(s) 569, 911
BssMI GATC 4 cut(s) 91, 205, 445, 787
Bst2UI CCWGG 3 cut(s) 44, 191, 968
Bst4CI ACNGT 6 cut(s) 352, 478, 580, 694, 820, 922
BstBI TTCGAA 1 cut(s) 852
BstC8I GCNNGC 2 cut(s) 567, 909
BstDEI CTNAG 5 cut(s) 97, 369, 561, 711, 903
BstF5I GGATG 3 cut(s) 123, 343, 685
BstFNI CGCG 3 cut(s) 104, 109, 211
BstKTI GATC 4 cut(s) 94, 208, 448, 790
BstMAI GTCTC 1 cut(s) 85
BstMBI GATC 4 cut(s) 91, 205, 445, 787
BstMWI GCNNNNNNNGC 6 cut(s) 31, 174, 405, 566, 747, 908
BstNI CCWGG 3 cut(s) 44, 191, 968
BstNSI RCATGY 4 cut(s) 334, 508, 676, 850
BstSCI CCNGG 4 cut(s) 42, 83, 189, 966
BstUI CGCG 3 cut(s) 104, 109, 211
BstV1I GCAGC 2 cut(s) 22, 238
BstV2I GAAGAC 1 cut(s) 763
BstX2I RGATCY 1 cut(s) 91
BstYI RGATCY 1 cut(s) 91
BsuRI GGCC 4 cut(s) 25, 47, 63, 129
BtgZI GCGATG 2 cut(s) 423, 765
BtsCI GGATG 3 cut(s) 123, 343, 685
BtsI GCAGTG 2 cut(s) 553, 895
BtsIMutI CAGTG 4 cut(s) 348, 553, 690, 895
BtuMI TCGCGA 1 cut(s) 109
Cac8I GCNNGC 2 cut(s) 567, 909
CciI TCATGA 1 cut(s) 202
Cfr10I RCCGGY 2 cut(s) 569, 911
Cfr13I GGNCC 6 cut(s) 23, 40, 46, 61, 128, 193
CseI GACGC 3 cut(s) 23, 93, 110
CsiI ACCWGGT 1 cut(s) 189
Csp6I GTAC 2 cut(s) 366, 708
CspCI CAANNNNNGTGG 2 cut(s) 292, 327
CviAII CATG 8 cut(s) 203, 239, 331, 505, 611, 673, 847, 978
CviQI GTAC 2 cut(s) 366, 708
DdeI CTNAG 5 cut(s) 97, 369, 561, 711, 903
DpnI GATC 4 cut(s) 93, 207, 447, 789
DpnII GATC 4 cut(s) 91, 205, 445, 787
EciI GGCGGA 2 cut(s) 311, 653
Eco31I GGTCTC 1 cut(s) 85
Eco47I GGWCC 2 cut(s) 40, 193
Eco57I CTGAAG 2 cut(s) 415, 757
EcoRII CCWGG 3 cut(s) 42, 189, 966
EcoT22I ATGCAT 1 cut(s) 616
FaeI CATG 8 cut(s) 206, 242, 334, 508, 614, 676, 850, 981
FaqI GGGAC 1 cut(s) 100
FatI CATG 8 cut(s) 202, 238, 330, 504, 610, 672, 846, 977
FauI CCCGC 1 cut(s) 161
FblI GTMKAC 3 cut(s) 534, 630, 876
Fnu4HI GCNGC 2 cut(s) 11, 252
FokI GGATG 3 cut(s) 130, 350, 692
Fsp4HI GCNGC 2 cut(s) 11, 252
GluI GCNGC 2 cut(s) 11, 252
GsuI CTGGAG 1 cut(s) 438
HaeIII GGCC 4 cut(s) 25, 47, 63, 129
HapII CCGG 4 cut(s) 38, 84, 570, 912
HgaI GACGC 3 cut(s) 23, 93, 110
Hin1II CATG 8 cut(s) 206, 242, 334, 508, 614, 676, 850, 981
HincII GTYRAC 5 cut(s) 289, 502, 535, 844, 877
HindII GTYRAC 5 cut(s) 289, 502, 535, 844, 877
HinfI GANTC 2 cut(s) 515, 857
HpaII CCGG 4 cut(s) 38, 84, 570, 912
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 7 cut(s) 289, 502, 535, 631, 796, 844, 877
Hpy188I TCNGA 6 cut(s) 73, 100, 337, 434, 679, 776
Hpy188III TCNNGA 3 cut(s) 38, 108, 203
Hpy8I GTNNAC 7 cut(s) 289, 502, 535, 631, 796, 844, 877
Hpy99I CGWCG 4 cut(s) 109, 221, 539, 881
HpyAV CCTTC 3 cut(s) 52, 577, 919
HpyCH4III ACNGT 6 cut(s) 352, 478, 580, 694, 820, 922
HpyCH4V TGCA 5 cut(s) 385, 487, 614, 727, 829
HpyF10VI GCNNNNNNNGC 6 cut(s) 31, 174, 405, 566, 747, 908
HpyF3I CTNAG 5 cut(s) 97, 369, 561, 711, 903
Hsp92II CATG 8 cut(s) 206, 242, 334, 508, 614, 676, 850, 981
Kpn2I TCCGGA 1 cut(s) 37
Kzo9I GATC 4 cut(s) 91, 205, 445, 787
LmnI GCTCC 4 cut(s) 149, 174, 324, 666
Lsp1109I GCAGC 2 cut(s) 22, 238
LweI GCATC 2 cut(s) 281, 623
MabI ACCWGGT 1 cut(s) 189
MaeIII GTNAC 4 cut(s) 340, 478, 682, 820
MalI GATC 4 cut(s) 93, 207, 447, 789
MboI GATC 4 cut(s) 91, 205, 445, 787
MboII GAAGA 8 cut(s) 60, 123, 172, 421, 599, 763, 866, 941
MflI RGATCY 1 cut(s) 91
MluCI AATT 5 cut(s) 264, 386, 455, 728, 953
MluI ACGCGT 1 cut(s) 102
MmeI TCCRAC 3 cut(s) 220, 315, 657
MnlI CCTC 7 cut(s) 106, 460, 516, 608, 802, 858, 950
Mph1103I ATGCAT 1 cut(s) 616
MroI TCCGGA 1 cut(s) 37
MslI CAYNNNNRTG 1 cut(s) 243
MspI CCGG 4 cut(s) 38, 84, 570, 912
MspR9I CCNGG 4 cut(s) 44, 85, 191, 968
MvaI CCWGG 3 cut(s) 44, 191, 968
MvnI CGCG 3 cut(s) 104, 109, 211
MwoI GCNNNNNNNGC 6 cut(s) 31, 174, 405, 566, 747, 908
NciI CCSGG 1 cut(s) 85
NdeII GATC 4 cut(s) 91, 205, 445, 787
NlaIII CATG 8 cut(s) 206, 242, 334, 508, 614, 676, 850, 981
NmuCI GTSAC 2 cut(s) 340, 682
NruI TCGCGA 1 cut(s) 109
NsiI ATGCAT 1 cut(s) 616
NspI RCATGY 4 cut(s) 334, 508, 676, 850
NspV TTCGAA 1 cut(s) 852
PagI TCATGA 1 cut(s) 202
PciI ACATGT 4 cut(s) 330, 504, 672, 846
PfeI GAWTC 2 cut(s) 515, 857
PfoI TCCNGGA 1 cut(s) 83
PkrI GCNGC 2 cut(s) 12, 253
PscI ACATGT 4 cut(s) 330, 504, 672, 846
Psp6I CCWGG 3 cut(s) 42, 189, 966
PspGI CCWGG 3 cut(s) 42, 189, 966
PspPI GGNCC 6 cut(s) 23, 40, 46, 61, 128, 193
PsuI RGATCY 1 cut(s) 91
RruI TCGCGA 1 cut(s) 109
RsaI GTAC 2 cut(s) 367, 709
RsaNI GTAC 2 cut(s) 366, 708
RseI CAYNNNNRTG 1 cut(s) 243
SalI GTCGAC 2 cut(s) 533, 875
SatI GCNGC 2 cut(s) 11, 252
Sau3AI GATC 4 cut(s) 91, 205, 445, 787
Sau96I GGNCC 6 cut(s) 23, 40, 46, 61, 128, 193
ScaI AGTACT 2 cut(s) 367, 709
ScrFI CCNGG 4 cut(s) 44, 85, 191, 968
SexAI ACCWGGT 1 cut(s) 189
SfaNI GCATC 2 cut(s) 281, 623
SfuI TTCGAA 1 cut(s) 852
SinI GGWCC 2 cut(s) 40, 193
SmiMI CAYNNNNRTG 1 cut(s) 243
Sse9I AATT 5 cut(s) 264, 386, 455, 728, 953
SsiI CCGC 5 cut(s) 168, 209, 243, 322, 664
StyD4I CCNGG 4 cut(s) 42, 83, 189, 966
TaaI ACNGT 6 cut(s) 352, 478, 580, 694, 820, 922
TaqI TCGA 4 cut(s) 135, 534, 852, 876
TasI AATT 5 cut(s) 264, 386, 455, 728, 953
TatI WGTACW 2 cut(s) 365, 707
TfiI GAWTC 2 cut(s) 515, 857
TscAI CASTG 4 cut(s) 355, 553, 697, 895
TseFI GTSAC 2 cut(s) 340, 682
TseI GCWGC 2 cut(s) 10, 251
Tsp45I GTSAC 2 cut(s) 340, 682
TspDTI ATGAA 6 cut(s) 191, 426, 476, 599, 768, 818
TspRI CASTG 4 cut(s) 355, 553, 697, 895
VpaK11BI GGWCC 2 cut(s) 40, 193
XapI RAATTY 1 cut(s) 953
XceI RCATGY 4 cut(s) 334, 508, 676, 850
XmiI GTMKAC 3 cut(s) 534, 630, 876
ZrmI AGTACT 2 cut(s) 367, 709
Zsp2I ATGCAT 1 cut(s) 616
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.