RchiOBHm_Chr3g0483741

Ubiquitin-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
30102284 .. 30102493
210 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 210 bp
ATGATTAAGGTGAAGACTCTTACCTGGAAAGAAATTGAGATTGATATTGAACCGACTGACACCATTAACCGAATCAAGGAAAGGGTTGAGGAGAAAGAGGGAATTCCTCCGGTGCAACAAAGGTACTTTTTTCTCCTTCTCAGATTCAATTTATCGAAAGTTATAACTTACTTGAACTTGAGTTATGTCTGGTTTTGTACTTTTGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

69

Amino Acids

8.4

Weight (kDa)

7.84

Isoelectric Point (pI)

40.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 2 - 44 1.7e-10 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017474)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 164
AcsI RAATTY 1 cut(s) 102
AfaI GTAC 2 cut(s) 125, 199
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 3 cut(s) 50, 148, 175
AjnI CCWGG 1 cut(s) 23
ApoI RAATTY 1 cut(s) 102
AsuHPI GGTGA 1 cut(s) 22
BbsI GAAGAC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 25
BfaI CTAG 1 cut(s) 208
Bme1390I CCNGG 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 25
BpiI GAAGAC 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 199
BsaWI WCCGGW 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 25
BseLI CCNNNNNNNGG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 154
BseRI GAGGAG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 76
BspCNI CTCAG 1 cut(s) 153
Bst2UI CCWGG 1 cut(s) 25
BstDEI CTNAG 1 cut(s) 140
BstNI CCWGG 1 cut(s) 25
BstSCI CCNGG 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 20
Csp6I GTAC 2 cut(s) 124, 198
CviQI GTAC 2 cut(s) 124, 198
DdeI CTNAG 1 cut(s) 140
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 23
FaiI YATR 2 cut(s) 164, 186
FspBI CTAG 1 cut(s) 208
HapII CCGG 1 cut(s) 110
HinfI GANTC 3 cut(s) 16, 72, 144
HpaII CCGG 1 cut(s) 110
HphI GGTGA 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 143
HpyAV CCTTC 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 115
HpyF3I CTNAG 1 cut(s) 140
LpnPI CCDG 4 cut(s) 10, 37, 123, 175
MaeI CTAG 1 cut(s) 208
MboII GAAGA 1 cut(s) 25
MluCI AATT 3 cut(s) 33, 102, 148
MlyI GAGTC 1 cut(s) 10
MnlI CCTC 3 cut(s) 82, 91, 117
MseI TTAA 2 cut(s) 6, 66
MspI CCGG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 25
MvaI CCWGG 1 cut(s) 25
PfeI GAWTC 2 cut(s) 72, 144
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
PsiI TTATAA 1 cut(s) 164
Psp6I CCWGG 1 cut(s) 23
PspGI CCWGG 1 cut(s) 23
RsaI GTAC 2 cut(s) 125, 199
RsaNI GTAC 2 cut(s) 124, 198
SaqAI TTAA 2 cut(s) 6, 66
SchI GAGTC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 25
SetI ASST 3 cut(s) 12, 26, 125
SgeI CNNG 7 cut(s) 36, 37, 88, 122, 184, 190, 202
SmlI CTYRAG 1 cut(s) 178
SmoI CTYRAG 1 cut(s) 178
Sse9I AATT 3 cut(s) 33, 102, 148
SspMI CTAG 1 cut(s) 208
StyD4I CCNGG 1 cut(s) 23
TaqI TCGA 1 cut(s) 155
TasI AATT 3 cut(s) 33, 102, 148
TatI WGTACW 1 cut(s) 197
TfiI GAWTC 2 cut(s) 72, 144
Tru1I TTAA 2 cut(s) 6, 66
Tru9I TTAA 2 cut(s) 6, 66
XapI RAATTY 1 cut(s) 102
XspI CTAG 1 cut(s) 208
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.