RchiOBHm_Chr4g0426441

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked Lys-48-linked is involved in protein degradation via the proteasome

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
51918352 .. 51918588
237 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39549

Sequence Viewer

Length: 237 bp
ATGATCGAGGTGAAGATTGATATTGAACTGACTGATACCATGAACCAAATTAGGGAAGGGGTTGAGGAGAAAGAGGGGATTCCTCCGCTGCAACAAAGGCTGATTTACGGTGGCAAGCAGCTTGGAGATGACAAAACTGCTGTAGAATACAAACTCGAGTGTGGCCCTGTCCTTCATCTTGTGCTTGCACTACGTGGTGGTAGTTTTTTATTAAGTAGTGATAGTATCTTTAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

78

Amino Acids

8.69

Weight (kDa)

4.84

Isoelectric Point (pI)

42.96

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 3 - 62 1.3e-08 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 4 - 64 1.4e-17 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017474)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 86
AdeI CACNNNGTG 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 1 cut(s) 26
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
Ama87I CYCGRG 1 cut(s) 155
AoxI GGCC 1 cut(s) 163
ApeKI GCWGC 2 cut(s) 88, 118
AspS9I GGNCC 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 22
AvaI CYCGRG 1 cut(s) 155
BbvI GCAGC 2 cut(s) 75, 130
BfmI CTRYAG 1 cut(s) 141
BisI GCNGC 2 cut(s) 89, 119
BlsI GCNGC 2 cut(s) 90, 120
BmeT110I CYCGRG 1 cut(s) 155
BmgT120I GGNCC 1 cut(s) 164
BsaAI YACGTR 1 cut(s) 194
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseLI CCNNNNNNNGG 1 cut(s) 52
BseRI GAGGAG 1 cut(s) 80
BseXI GCAGC 2 cut(s) 75, 130
BshFI GGCC 1 cut(s) 165
BsiHKCI CYCGRG 1 cut(s) 155
BslI CCNNNNNNNGG 1 cut(s) 52
BsnI GGCC 1 cut(s) 165
BsoBI CYCGRG 1 cut(s) 155
Bsp143I GATC 1 cut(s) 3
BspACI CCGC 1 cut(s) 86
BspANI GGCC 1 cut(s) 165
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 110
BstBAI YACGTR 1 cut(s) 194
BstC8I GCNNGC 2 cut(s) 116, 186
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 1 cut(s) 97
BstSFI CTRYAG 1 cut(s) 141
BstV1I GCAGC 2 cut(s) 75, 130
BsuRI GGCC 1 cut(s) 165
Cac8I GCNNGC 2 cut(s) 116, 186
Cfr13I GGNCC 1 cut(s) 164
CviAII CATG 1 cut(s) 40
CviJI RGCY 3 cut(s) 100, 121, 165
CviKI_1 RGCY 3 cut(s) 100, 121, 165
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
DraI TTTAAA 1 cut(s) 232
DraIII CACNNNGTG 1 cut(s) 194
Eco88I CYCGRG 1 cut(s) 155
FaeI CATG 1 cut(s) 43
FaiI YATR 1 cut(s) 41
FatI CATG 1 cut(s) 39
Fnu4HI GCNGC 2 cut(s) 89, 119
Fsp4HI GCNGC 2 cut(s) 89, 119
GluI GCNGC 2 cut(s) 89, 119
HaeIII GGCC 1 cut(s) 165
Hin1II CATG 1 cut(s) 43
HinfI GANTC 1 cut(s) 79
HphI GGTGA 1 cut(s) 22
HpyAV CCTTC 2 cut(s) 50, 182
HpyCH4III ACNGT 1 cut(s) 110
HpyCH4IV ACGT 1 cut(s) 193
HpyCH4V TGCA 2 cut(s) 91, 188
HpyF10VI GCNNNNNNNGC 1 cut(s) 97
HpySE526I ACGT 1 cut(s) 193
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 1 cut(s) 3
LpnPI CCDG 1 cut(s) 180
Lsp1109I GCAGC 2 cut(s) 75, 130
MaeII ACGT 1 cut(s) 193
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 25
MluCI AATT 1 cut(s) 48
MnlI CCTC 3 cut(s) 58, 67, 93
MseI TTAA 2 cut(s) 212, 231
MspA1I CMGCKG 1 cut(s) 88
MwoI GCNNNNNNNGC 1 cut(s) 97
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 43
PaeR7I CTCGAG 1 cut(s) 155
PfeI GAWTC 1 cut(s) 79
PkrI GCNGC 2 cut(s) 90, 120
Ppu21I YACGTR 1 cut(s) 194
PspPI GGNCC 1 cut(s) 164
PspXI VCTCGAGB 1 cut(s) 155
SaqAI TTAA 2 cut(s) 212, 231
SatI GCNGC 2 cut(s) 89, 119
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 164
SetI ASST 3 cut(s) 12, 123, 196
SfcI CTRYAG 1 cut(s) 141
Sfr274I CTCGAG 1 cut(s) 155
SlaI CTCGAG 1 cut(s) 155
SmlI CTYRAG 1 cut(s) 155
SmoI CTYRAG 1 cut(s) 155
Sse9I AATT 1 cut(s) 48
SsiI CCGC 1 cut(s) 86
TaaI ACNGT 1 cut(s) 110
TaiI ACGT 1 cut(s) 196
TaqI TCGA 2 cut(s) 6, 156
TasI AATT 1 cut(s) 48
TfiI GAWTC 1 cut(s) 79
Tru1I TTAA 2 cut(s) 212, 231
Tru9I TTAA 2 cut(s) 212, 231
TseI GCWGC 2 cut(s) 88, 118
TspDTI ATGAA 2 cut(s) 56, 164
XhoI CTCGAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.