Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr3A

Orthogroup ID

OG0017474

Physical Location & Seq

Genomic Coordinates Forward (+)

21757723 .. 21788773

Gene Structure 31051 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh3AG215800.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 228 bp

ATGATTAAGGTGAAGGCTCTTACTGTGAAAGAAATTGAGATTGATATAGACCCGATTGACACCATTGGCCTAATCAAGGAAAGGGTTGAGGAGAAAGAGGGAGTTCCTCCGGTGCAACAGAGTAGACTCTTTGCACAAGCTCTGTATGTTGTCCGTAAAACATTAAAGGCTGATAAAGAGGAGAGAGAGAGAAGTTGGAGTCAGGGGAAAATAGAAGCGGTGTCTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ubiquitin

Protein Analysis

75

Amino Acids

8.58

Weight (kDa)

6.29

Isoelectric Point (pI)

50.71

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
ubiquitin	PF00240	2 - 44	4.6e-08	Ubiquitin family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017474)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11980
fragaria_vesca	FvH4_5g22621
malus_domestica	MD07G1147200.v1.1
rosa_chinensis	RchiOBHm_Chr3g0478011 RchiOBHm_Chr3g0478541 RchiOBHm_Chr3g0483741 RchiOBHm_Chr4g0426441
rosa_roxburghii	Rroxscaffold_6G00403310
rosa_samantha	Rh3AG215800 Rh3AG256600 Rh3BG173200 Rh3BG302700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccI	GTMKAC	1 cut(s)	124
AciI	CCGC	1 cut(s)	218
AfiI	CCNNNNNNNGG	1 cut(s)	76
AluBI	AGCT	1 cut(s)	140
AluI	AGCT	1 cut(s)	140
AoxI	GGCC	1 cut(s)	67
AsuHPI	GGTGA	1 cut(s)	22
BsaWI	WCCGGW	1 cut(s)	109
Bsc4I	CCNNNNNNNGG	1 cut(s)	76
BseLI	CCNNNNNNNGG	1 cut(s)	76
BseRI	GAGGAG	2 cut(s)	104, 194
BshFI	GGCC	1 cut(s)	69
BsiSI	CCGG	1 cut(s)	110
BslI	CCNNNNNNNGG	1 cut(s)	76
BsnI	GGCC	1 cut(s)	69
BspACI	CCGC	1 cut(s)	218
BspANI	GGCC	1 cut(s)	69
Bst4CI	ACNGT	1 cut(s)	25
BstENI	CCTNNNNNAGG	1 cut(s)	74
BsuRI	GGCC	1 cut(s)	69
CviJI	RGCY	4 cut(s)	17, 69, 140, 170
CviKI_1	RGCY	4 cut(s)	17, 69, 140, 170
EcoNI	CCTNNNNNAGG	1 cut(s)	74
FaiI	YATR	2 cut(s)	47, 147
FblI	GTMKAC	1 cut(s)	124
HaeIII	GGCC	1 cut(s)	69
HapII	CCGG	1 cut(s)	110
HinfI	GANTC	2 cut(s)	126, 199
HpaII	CCGG	1 cut(s)	110
HphI	GGTGA	1 cut(s)	22
Hpy166II	GTNNAC	1 cut(s)	125
Hpy8I	GTNNAC	1 cut(s)	125
HpyAV	CCTTC	1 cut(s)	7
HpyCH4III	ACNGT	1 cut(s)	25
HpyCH4V	TGCA	2 cut(s)	115, 134
LpnPI	CCDG	2 cut(s)	123, 188
MluCI	AATT	1 cut(s)	33
MlyI	GAGTC	2 cut(s)	120, 208
MmeI	TCCRAC	1 cut(s)	176
MnlI	CCTC	4 cut(s)	82, 91, 117, 172
MseI	TTAA	3 cut(s)	6, 164, 226
MspI	CCGG	1 cut(s)	110
PleI	GAGTC	2 cut(s)	120, 207
PpsI	GAGTC	2 cut(s)	120, 207
SaqAI	TTAA	3 cut(s)	6, 164, 226
SchI	GAGTC	2 cut(s)	120, 208
SetI	ASST	2 cut(s)	12, 142
SgeI	CNNG	5 cut(s)	64, 88, 122, 149, 215
Sse9I	AATT	1 cut(s)	33
SsiI	CCGC	1 cut(s)	218
TaaI	ACNGT	1 cut(s)	25
TasI	AATT	1 cut(s)	33
Tru1I	TTAA	3 cut(s)	6, 164, 226
Tru9I	TTAA	3 cut(s)	6, 164, 226
TspGWI	ACGGA	1 cut(s)	143
XagI	CCTNNNNNAGG	1 cut(s)	74
XmiI	GTMKAC	1 cut(s)	124

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.