Rh3AG256600

Ubiquitin-like domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
OG0017474
Physical Location & Seq
Forward (+)
28298053 .. 28310012
11960 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG256600.1

Sequence Viewer

Length: 192 bp
ATGATTAAGGTGAAGACTCTTACCTGGAAAGAAATTGAGATTGATATTGAACCGACTGACACCATTAACCGAATCAAGGAAAGGGTTGAGGAGAAAGAGGGAATTCCTCCGGTGCAACAAAGAGCAAAGCATGTTAAAACCACACACATCCTAAACAAGATCGCAGGTCTAAAATTTGAACTGATGCGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

63

Amino Acids

7.44

Weight (kDa)

9.45

Isoelectric Point (pI)

45.67

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 2 - 41 5e-10 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017474)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G11980
fragaria_vesca FvH4_5g22621
malus_domestica MD07G1147200.v1.1
rosa_chinensis RchiOBHm_Chr3g0478011 RchiOBHm_Chr3g0478541 RchiOBHm_Chr3g0483741 RchiOBHm_Chr4g0426441
rosa_roxburghii Rroxscaffold_6G00403310
rosa_samantha Rh3AG215800 Rh3AG256600 Rh3BG173200 Rh3BG302700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 155
AcsI RAATTY 2 cut(s) 102, 173
AfiI CCNNNNNNNGG 1 cut(s) 76
AgsI TTSAA 2 cut(s) 50, 179
AjnI CCWGG 1 cut(s) 23
ApoI RAATTY 2 cut(s) 102, 173
AspLEI GCGC 1 cut(s) 189
AsuHPI GGTGA 1 cut(s) 22
BbsI GAAGAC 1 cut(s) 20
BciT130I CCWGG 1 cut(s) 25
BfaI CTAG 1 cut(s) 190
BfuAI ACCTGC 1 cut(s) 155
Bme1390I CCNGG 1 cut(s) 25
BmrFI CCNGG 1 cut(s) 25
BmsI GCATC 1 cut(s) 174
BpiI GAAGAC 1 cut(s) 20
BsaWI WCCGGW 1 cut(s) 109
Bsc4I CCNNNNNNNGG 1 cut(s) 76
BseBI CCWGG 1 cut(s) 25
BseGI GGATG 1 cut(s) 147
BseLI CCNNNNNNNGG 1 cut(s) 76
BseRI GAGGAG 1 cut(s) 104
BsiSI CCGG 1 cut(s) 110
BslI CCNNNNNNNGG 1 cut(s) 76
Bsp143I GATC 1 cut(s) 159
BspMI ACCTGC 1 cut(s) 155
BssMI GATC 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 25
BstF5I GGATG 1 cut(s) 147
BstHHI GCGC 1 cut(s) 189
BstKTI GATC 1 cut(s) 162
BstMBI GATC 1 cut(s) 159
BstNI CCWGG 1 cut(s) 25
BstNSI RCATGY 1 cut(s) 134
BstSCI CCNGG 1 cut(s) 23
BstV2I GAAGAC 1 cut(s) 20
BtsCI GGATG 1 cut(s) 147
BveI ACCTGC 1 cut(s) 155
CfoI GCGC 1 cut(s) 189
CviAII CATG 1 cut(s) 131
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
EcoRI GAATTC 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 23
FaeI CATG 1 cut(s) 134
FaiI YATR 1 cut(s) 132
FatI CATG 1 cut(s) 130
FokI GGATG 1 cut(s) 134
FspBI CTAG 1 cut(s) 190
GlaI GCGC 1 cut(s) 188
HapII CCGG 1 cut(s) 110
HhaI GCGC 1 cut(s) 189
Hin1II CATG 1 cut(s) 134
Hin6I GCGC 1 cut(s) 187
HinP1I GCGC 1 cut(s) 187
HinfI GANTC 2 cut(s) 16, 72
HpaII CCGG 1 cut(s) 110
HphI GGTGA 1 cut(s) 22
HpyCH4V TGCA 1 cut(s) 115
Hsp92II CATG 1 cut(s) 134
HspAI GCGC 1 cut(s) 187
Kzo9I GATC 1 cut(s) 159
LpnPI CCDG 4 cut(s) 10, 37, 123, 150
LweI GCATC 1 cut(s) 174
MaeI CTAG 1 cut(s) 190
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 25
MluCI AATT 3 cut(s) 33, 102, 173
MlyI GAGTC 1 cut(s) 10
MnlI CCTC 3 cut(s) 82, 91, 117
MseI TTAA 3 cut(s) 6, 66, 135
MspI CCGG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 25
MvaI CCWGG 1 cut(s) 25
NdeII GATC 1 cut(s) 159
NlaIII CATG 1 cut(s) 134
NspI RCATGY 1 cut(s) 134
PfeI GAWTC 1 cut(s) 72
PleI GAGTC 1 cut(s) 10
PpsI GAGTC 1 cut(s) 10
Psp6I CCWGG 1 cut(s) 23
PspGI CCWGG 1 cut(s) 23
SaqAI TTAA 3 cut(s) 6, 66, 135
Sau3AI GATC 1 cut(s) 159
SchI GAGTC 1 cut(s) 10
ScrFI CCNGG 1 cut(s) 25
SetI ASST 3 cut(s) 12, 26, 169
SfaNI GCATC 1 cut(s) 174
SgeI CNNG 7 cut(s) 36, 37, 88, 122, 143, 169, 177
Sse9I AATT 3 cut(s) 33, 102, 173
SspMI CTAG 1 cut(s) 190
StyD4I CCNGG 1 cut(s) 23
TasI AATT 3 cut(s) 33, 102, 173
TfiI GAWTC 1 cut(s) 72
Tru1I TTAA 3 cut(s) 6, 66, 135
Tru9I TTAA 3 cut(s) 6, 66, 135
XapI RAATTY 2 cut(s) 102, 173
XceI RCATGY 1 cut(s) 134
XspI CTAG 1 cut(s) 190
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.