Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0017474

Physical Location & Seq

Genomic Coordinates Forward (+)

30102284 .. 30102493

Gene Structure 210 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ44848

Sequence Viewer

CDS Protein Promoter (2k)

Length: 210 bp

ATGATTAAGGTGAAGACTCTTACCTGGAAAGAAATTGAGATTGATATTGAACCGACTGACACCATTAACCGAATCAAGGAAAGGGTTGAGGAGAAAGAGGGAATTCCTCCGGTGCAACAAAGGTACTTTTTTCTCCTTCTCAGATTCAATTTATCGAAAGTTATAACTTACTTGAACTTGAGTTATGTCTGGTTTTGTACTTTTGTCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

ubiquitin

Protein Analysis

69

Amino Acids

8.4

Weight (kDa)

7.84

Isoelectric Point (pI)

40.93

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
ubiquitin	PF00240	2 - 44	1.7e-10	Ubiquitin family

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017474)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G11980
fragaria_vesca	FvH4_5g22621
malus_domestica	MD07G1147200.v1.1
rosa_chinensis	RchiOBHm_Chr3g0478011 RchiOBHm_Chr3g0478541 RchiOBHm_Chr3g0483741 RchiOBHm_Chr4g0426441
rosa_roxburghii	Rroxscaffold_6G00403310
rosa_samantha	Rh3AG215800 Rh3AG256600 Rh3BG173200 Rh3BG302700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	164
AcsI	RAATTY	1 cut(s)	102
AfaI	GTAC	2 cut(s)	125, 199
AfiI	CCNNNNNNNGG	1 cut(s)	76
AgsI	TTSAA	3 cut(s)	50, 148, 175
AjnI	CCWGG	1 cut(s)	23
ApoI	RAATTY	1 cut(s)	102
AsuHPI	GGTGA	1 cut(s)	22
BbsI	GAAGAC	1 cut(s)	20
BciT130I	CCWGG	1 cut(s)	25
BfaI	CTAG	1 cut(s)	208
Bme1390I	CCNGG	1 cut(s)	25
BmrFI	CCNGG	1 cut(s)	25
BpiI	GAAGAC	1 cut(s)	20
BpuEI	CTTGAG	1 cut(s)	199
BsaWI	WCCGGW	1 cut(s)	109
Bsc4I	CCNNNNNNNGG	1 cut(s)	76
BseBI	CCWGG	1 cut(s)	25
BseLI	CCNNNNNNNGG	1 cut(s)	76
BseMII	CTCAG	1 cut(s)	154
BseRI	GAGGAG	1 cut(s)	104
BsiSI	CCGG	1 cut(s)	110
BslI	CCNNNNNNNGG	1 cut(s)	76
BspCNI	CTCAG	1 cut(s)	153
Bst2UI	CCWGG	1 cut(s)	25
BstDEI	CTNAG	1 cut(s)	140
BstNI	CCWGG	1 cut(s)	25
BstSCI	CCNGG	1 cut(s)	23
BstV2I	GAAGAC	1 cut(s)	20
Csp6I	GTAC	2 cut(s)	124, 198
CviQI	GTAC	2 cut(s)	124, 198
DdeI	CTNAG	1 cut(s)	140
EcoRI	GAATTC	1 cut(s)	102
EcoRII	CCWGG	1 cut(s)	23
FaiI	YATR	2 cut(s)	164, 186
FspBI	CTAG	1 cut(s)	208
HapII	CCGG	1 cut(s)	110
HinfI	GANTC	3 cut(s)	16, 72, 144
HpaII	CCGG	1 cut(s)	110
HphI	GGTGA	1 cut(s)	22
Hpy188I	TCNGA	1 cut(s)	143
HpyAV	CCTTC	1 cut(s)	146
HpyCH4V	TGCA	1 cut(s)	115
HpyF3I	CTNAG	1 cut(s)	140
LpnPI	CCDG	4 cut(s)	10, 37, 123, 175
MaeI	CTAG	1 cut(s)	208
MboII	GAAGA	1 cut(s)	25
MluCI	AATT	3 cut(s)	33, 102, 148
MlyI	GAGTC	1 cut(s)	10
MnlI	CCTC	3 cut(s)	82, 91, 117
MseI	TTAA	2 cut(s)	6, 66
MspI	CCGG	1 cut(s)	110
MspR9I	CCNGG	1 cut(s)	25
MvaI	CCWGG	1 cut(s)	25
PfeI	GAWTC	2 cut(s)	72, 144
PleI	GAGTC	1 cut(s)	10
PpsI	GAGTC	1 cut(s)	10
PsiI	TTATAA	1 cut(s)	164
Psp6I	CCWGG	1 cut(s)	23
PspGI	CCWGG	1 cut(s)	23
RsaI	GTAC	2 cut(s)	125, 199
RsaNI	GTAC	2 cut(s)	124, 198
SaqAI	TTAA	2 cut(s)	6, 66
SchI	GAGTC	1 cut(s)	10
ScrFI	CCNGG	1 cut(s)	25
SetI	ASST	3 cut(s)	12, 26, 125
SgeI	CNNG	7 cut(s)	36, 37, 88, 122, 184, 190, 202
SmlI	CTYRAG	1 cut(s)	178
SmoI	CTYRAG	1 cut(s)	178
Sse9I	AATT	3 cut(s)	33, 102, 148
SspMI	CTAG	1 cut(s)	208
StyD4I	CCNGG	1 cut(s)	23
TaqI	TCGA	1 cut(s)	155
TasI	AATT	3 cut(s)	33, 102, 148
TatI	WGTACW	1 cut(s)	197
TfiI	GAWTC	2 cut(s)	72, 144
Tru1I	TTAA	2 cut(s)	6, 66
Tru9I	TTAA	2 cut(s)	6, 66
XapI	RAATTY	1 cut(s)	102
XspI	CTAG	1 cut(s)	208

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.