Rh3BG302700

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Reverse (-)
30534524 .. 30534685
162 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG302700.1

Sequence Viewer

Length: 162 bp
ATGCAGATCTTCGTGAAAACCGTAACGAGGAAGACGATCACCCTGGAGGTGGAGTCGTCGGACACCATCGACAACGTGAAGGCCAAGATTCAAGACAAGGAGGGCATCCCGCCGGACCAGCAGAGGCTCATCTTCGCCGGAAAGCAGCTCGAGGACGGCTGA

Protein Analysis

53

Amino Acids

5.97

Weight (kDa)

5.17

Isoelectric Point (pI)

20.75

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 52 5.6e-11 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 52 5e-21 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017474)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 110
AfiI CCNNNNNNNGG 2 cut(s) 27, 49
AgsI TTSAA 1 cut(s) 92
AjnI CCWGG 1 cut(s) 42
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Ama87I CYCGRG 1 cut(s) 149
AoxI GGCC 1 cut(s) 81
ApeKI GCWGC 1 cut(s) 145
AspS9I GGNCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 31
AvaI CYCGRG 1 cut(s) 149
AvaII GGWCC 1 cut(s) 115
BbsI GAAGAC 1 cut(s) 38
BbvI GCAGC 1 cut(s) 157
BccI CCATC 1 cut(s) 74
BciT130I CCWGG 1 cut(s) 44
BglII AGATCT 1 cut(s) 6
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
Bme1390I CCNGG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 115
BmeT110I CYCGRG 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 115
BmrFI CCNGG 1 cut(s) 44
BmsI GCATC 1 cut(s) 114
BpiI GAAGAC 1 cut(s) 38
BpmI CTGGAG 1 cut(s) 65
BsaJI CCNNGG 1 cut(s) 42
BsaXI ACNNNNNCTCC 2 cut(s) 38, 68
Bsc4I CCNNNNNNNGG 2 cut(s) 27, 49
BseBI CCWGG 1 cut(s) 44
BseDI CCNNGG 1 cut(s) 42
BseGI GGATG 1 cut(s) 105
BseLI CCNNNNNNNGG 2 cut(s) 27, 49
BseXI GCAGC 1 cut(s) 157
BshFI GGCC 1 cut(s) 83
BsiHKCI CYCGRG 1 cut(s) 149
BsiSI CCGG 2 cut(s) 113, 138
BslI CCNNNNNNNGG 2 cut(s) 27, 49
BsnI GGCC 1 cut(s) 83
BsoBI CYCGRG 1 cut(s) 149
Bsp143I GATC 2 cut(s) 6, 36
BspACI CCGC 1 cut(s) 110
BspANI GGCC 1 cut(s) 83
BssECI CCNNGG 1 cut(s) 42
BssMI GATC 2 cut(s) 6, 36
Bst2UI CCWGG 1 cut(s) 44
Bst4CI ACNGT 1 cut(s) 22
BstF5I GGATG 1 cut(s) 105
BstKTI GATC 2 cut(s) 9, 39
BstMBI GATC 2 cut(s) 6, 36
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstNI CCWGG 1 cut(s) 44
BstSCI CCNGG 1 cut(s) 42
BstV1I GCAGC 1 cut(s) 157
BstV2I GAAGAC 1 cut(s) 38
BstX2I RGATCY 1 cut(s) 6
BstYI RGATCY 1 cut(s) 6
BsuRI GGCC 1 cut(s) 83
BtsCI GGATG 1 cut(s) 105
Cfr13I GGNCC 1 cut(s) 115
CviJI RGCY 4 cut(s) 83, 127, 148, 159
CviKI_1 RGCY 4 cut(s) 83, 127, 148, 159
DpnI GATC 2 cut(s) 8, 38
DpnII GATC 2 cut(s) 6, 36
Eco47I GGWCC 1 cut(s) 115
Eco88I CYCGRG 1 cut(s) 149
EcoRII CCWGG 1 cut(s) 42
FauI CCCGC 1 cut(s) 117
Fnu4HI GCNGC 1 cut(s) 146
FokI GGATG 1 cut(s) 92
Fsp4HI GCNGC 1 cut(s) 146
GluI GCNGC 1 cut(s) 146
GsuI CTGGAG 1 cut(s) 65
HaeIII GGCC 1 cut(s) 83
HapII CCGG 2 cut(s) 113, 138
HinfI GANTC 2 cut(s) 53, 88
HpaII CCGG 2 cut(s) 113, 138
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 1 cut(s) 61
Hpy188III TCNNGA 2 cut(s) 13, 92
Hpy99I CGWCG 1 cut(s) 61
HpyAV CCTTC 1 cut(s) 73
HpyCH4III ACNGT 1 cut(s) 22
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpySE526I ACGT 1 cut(s) 75
Kzo9I GATC 2 cut(s) 6, 36
LpnPI CCDG 5 cut(s) 29, 56, 126, 131, 151
Lsp1109I GCAGC 1 cut(s) 157
LweI GCATC 1 cut(s) 114
MaeII ACGT 1 cut(s) 75
MaeIII GTNAC 1 cut(s) 22
MalI GATC 2 cut(s) 8, 38
MboI GATC 2 cut(s) 6, 36
MboII GAAGA 2 cut(s) 43, 124
MflI RGATCY 1 cut(s) 6
MlyI GAGTC 1 cut(s) 62
MmeI TCCRAC 1 cut(s) 39
MnlI CCTC 5 cut(s) 21, 40, 94, 117, 145
MspI CCGG 2 cut(s) 113, 138
MspR9I CCNGG 1 cut(s) 44
MvaI CCWGG 1 cut(s) 44
MwoI GCNNNNNNNGC 1 cut(s) 118
NdeII GATC 2 cut(s) 6, 36
PaeR7I CTCGAG 1 cut(s) 149
PcsI WCGNNNNNNNCGW 2 cut(s) 18, 32
PfeI GAWTC 1 cut(s) 88
PkrI GCNGC 1 cut(s) 147
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 42
PspGI CCWGG 1 cut(s) 42
PspPI GGNCC 1 cut(s) 115
PspXI VCTCGAGB 1 cut(s) 149
PsuI RGATCY 1 cut(s) 6
SatI GCNGC 1 cut(s) 146
Sau3AI GATC 2 cut(s) 6, 36
Sau96I GGNCC 1 cut(s) 115
SchI GAGTC 1 cut(s) 62
ScrFI CCNGG 1 cut(s) 44
SetI ASST 3 cut(s) 51, 78, 150
SfaNI GCATC 1 cut(s) 114
Sfr274I CTCGAG 1 cut(s) 149
SinI GGWCC 1 cut(s) 115
SlaI CTCGAG 1 cut(s) 149
SmlI CTYRAG 1 cut(s) 149
SmoI CTYRAG 1 cut(s) 149
SsiI CCGC 1 cut(s) 110
StyD4I CCNGG 1 cut(s) 42
TaaI ACNGT 1 cut(s) 22
TaiI ACGT 1 cut(s) 78
TaqI TCGA 2 cut(s) 69, 150
TfiI GAWTC 1 cut(s) 88
TseI GCWGC 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 115
XhoI CTCGAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.