Rroxscaffold_6G00403310

ubiquitin-NEDD8-like protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000006
Physical Location & Seq
Reverse (-)
25770769 .. 25785269
14501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_6G00403310.1

Sequence Viewer

Length: 150 bp
ATGGTTGAGGAGAAAGAGGGAATTCCTCCGGTGCGACAAAGGCTGATTTATGCTGGCAAGCTTGGAGATGAGAAAACTGCAAAAGACTACAACATTGAAGGTGGCTTTGTCCTTCATTTACTGCCTGCACTACGTGGTGGTAGTCTATAA

Protein Analysis

49

Amino Acids

5.38

Weight (kDa)

6.54

Isoelectric Point (pI)

60.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ubiquitin PF00240 2 - 41 6.4e-11 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017474)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 21
AdeI CACNNNGTG 1 cut(s) 134
AgsI TTSAA 1 cut(s) 98
AluBI AGCT 1 cut(s) 61
AluI AGCT 1 cut(s) 61
ApoI RAATTY 1 cut(s) 21
BsaAI YACGTR 1 cut(s) 134
BsaWI WCCGGW 1 cut(s) 28
BseRI GAGGAG 1 cut(s) 23
BsgI GTGCAG 1 cut(s) 111
BsiSI CCGG 1 cut(s) 29
BstBAI YACGTR 1 cut(s) 134
BstC8I GCNNGC 3 cut(s) 55, 59, 126
BstMWI GCNNNNNNNGC 1 cut(s) 40
Cac8I GCNNGC 3 cut(s) 55, 59, 126
CviJI RGCY 3 cut(s) 43, 61, 105
CviKI_1 RGCY 3 cut(s) 43, 61, 105
DraIII CACNNNGTG 1 cut(s) 134
EcoRI GAATTC 1 cut(s) 21
FaiI YATR 2 cut(s) 51, 148
HapII CCGG 1 cut(s) 29
HindIII AAGCTT 1 cut(s) 59
HpaII CCGG 1 cut(s) 29
HpyAV CCTTC 2 cut(s) 92, 122
HpyCH4IV ACGT 1 cut(s) 133
HpyCH4V TGCA 2 cut(s) 80, 128
HpyF10VI GCNNNNNNNGC 1 cut(s) 40
HpySE526I ACGT 1 cut(s) 133
LpnPI CCDG 3 cut(s) 39, 42, 138
MaeII ACGT 1 cut(s) 133
MluCI AATT 1 cut(s) 21
MnlI CCTC 2 cut(s) 10, 36
MspI CCGG 1 cut(s) 29
MwoI GCNNNNNNNGC 1 cut(s) 40
Ppu21I YACGTR 1 cut(s) 134
SetI ASST 3 cut(s) 63, 103, 136
SgeI CNNG 6 cut(s) 41, 66, 70, 74, 137, 146
Sse9I AATT 1 cut(s) 21
TaiI ACGT 1 cut(s) 136
TasI AATT 1 cut(s) 21
TspDTI ATGAA 1 cut(s) 104
XapI RAATTY 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.