Rh3BG173200

Ubiquitin exists either covalently attached to another protein, or free (unanchored). When covalently bound, it is conjugated to target proteins via an isopeptide bond either as a monomer (monoubiquitin), a polymer linked via different Lys residues of the ubiquitin (polyubiquitin chains) or a linear polymer linked via the initiator Met of the ubiquitin (linear polyubiquitin chains). Polyubiquitin chains, when attached to a target protein, have different functions depending on the Lys residue of the ubiquitin that is linked

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0017474
Physical Location & Seq
Reverse (-)
14853704 .. 14854571
868 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG173200.1

Sequence Viewer

Length: 237 bp
ATGCAGATCTTTGTGAAAACCTTAACCGGCAAGACCATCACCCTCGAGGTCGAGAGCTCTGACACGATCGACAACGTCAAGGCCAAGATCCAAGATAAGGAGGGAATCCCGCCAGACCAGCAGAGGCTCATCTTCGCAGGAAAGCAGCTCGAGGATGGCCGAACTTTGGCTGATTATAATATTCAGAAGGAATCCACACTCCACCTTGTCCTTCGTCTCCGCGGTGGTGATTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03320 map03320
Pfam Domains
Protein Families
ubiquitin

Protein Analysis

78

Amino Acids

8.79

Weight (kDa)

5.72

Isoelectric Point (pI)

27.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 1 - 71 1.8e-18 Ubiquitin-2 like Rad60 SUMO-like
ubiquitin PF00240 3 - 74 2.3e-33 Ubiquitin family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017474)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G11980
fragaria_vesca FvH4_5g22621
malus_domestica MD07G1147200.v1.1
rosa_chinensis RchiOBHm_Chr3g0478011 RchiOBHm_Chr3g0478541 RchiOBHm_Chr3g0483741 RchiOBHm_Chr4g0426441
rosa_roxburghii Rroxscaffold_6G00403310
rosa_samantha Rh3AG215800 Rh3AG256600 Rh3BG173200 Rh3BG302700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 177
AbsI CCTCGAGG 1 cut(s) 44
AccII CGCG 1 cut(s) 222
AciI CCGC 3 cut(s) 110, 220, 222
AclWI GGATC 1 cut(s) 82
AcoI YGGCCR 1 cut(s) 157
AfiI CCNNNNNNNGG 2 cut(s) 97, 166
AluBI AGCT 2 cut(s) 57, 148
AluI AGCT 2 cut(s) 57, 148
Alw21I GWGCWC 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 221
AlwI GGATC 1 cut(s) 82
Ama87I CYCGRG 2 cut(s) 44, 149
AoxI GGCC 2 cut(s) 81, 157
ApeKI GCWGC 1 cut(s) 145
AsuHPI GGTGA 1 cut(s) 31
AvaI CYCGRG 2 cut(s) 44, 149
BanII GRGCYC 1 cut(s) 59
Bbv12I GWGCWC 1 cut(s) 59
BbvI GCAGC 1 cut(s) 157
BccI CCATC 2 cut(s) 44, 149
BcoDI GTCTC 1 cut(s) 221
BglII AGATCT 1 cut(s) 6
BisI GCNGC 1 cut(s) 146
BlsI GCNGC 1 cut(s) 147
BmeT110I CYCGRG 2 cut(s) 44, 149
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 2 cut(s) 97, 166
Bse118I RCCGGY 1 cut(s) 26
BseDI CCNNGG 1 cut(s) 220
BseGI GGATG 1 cut(s) 160
BseLI CCNNNNNNNGG 2 cut(s) 97, 166
BseXI GCAGC 1 cut(s) 157
Bsh1236I CGCG 1 cut(s) 222
Bsh1285I CGRYCG 1 cut(s) 69
BshFI GGCC 2 cut(s) 83, 159
BsiEI CGRYCG 1 cut(s) 69
BsiHKAI GWGCWC 1 cut(s) 59
BsiHKCI CYCGRG 2 cut(s) 44, 149
BsiSI CCGG 1 cut(s) 27
BslI CCNNNNNNNGG 2 cut(s) 97, 166
BsmAI GTCTC 1 cut(s) 221
BsmBI CGTCTC 1 cut(s) 221
BsnI GGCC 2 cut(s) 83, 159
BsoBI CYCGRG 2 cut(s) 44, 149
Bsp1286I GDGCHC 1 cut(s) 59
Bsp143I GATC 3 cut(s) 6, 66, 87
BspACI CCGC 3 cut(s) 110, 220, 222
BspANI GGCC 2 cut(s) 83, 159
BspFNI CGCG 1 cut(s) 222
BspPI GGATC 1 cut(s) 82
BsrFI RCCGGY 1 cut(s) 26
BssAI RCCGGY 1 cut(s) 26
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 3 cut(s) 6, 66, 87
BstDSI CCRYGG 1 cut(s) 220
BstF5I GGATG 1 cut(s) 160
BstFNI CGCG 1 cut(s) 222
BstKTI GATC 3 cut(s) 9, 69, 90
BstMAI GTCTC 1 cut(s) 221
BstMBI GATC 3 cut(s) 6, 66, 87
BstMCI CGRYCG 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstUI CGCG 1 cut(s) 222
BstV1I GCAGC 1 cut(s) 157
BstX2I RGATCY 2 cut(s) 6, 87
BstYI RGATCY 2 cut(s) 6, 87
BsuRI GGCC 2 cut(s) 83, 159
BtgI CCRYGG 1 cut(s) 220
BtsCI GGATG 1 cut(s) 160
Cfr10I RCCGGY 1 cut(s) 26
Cfr42I CCGCGG 1 cut(s) 223
CviJI RGCY 6 cut(s) 57, 83, 127, 148, 159, 170
CviKI_1 RGCY 6 cut(s) 57, 83, 127, 148, 159, 170
DpnI GATC 3 cut(s) 8, 68, 89
DpnII GATC 3 cut(s) 6, 66, 87
EaeI YGGCCR 1 cut(s) 157
Ecl136II GAGCTC 1 cut(s) 57
Eco24I GRGCYC 1 cut(s) 59
Eco53kI GAGCTC 1 cut(s) 57
Eco88I CYCGRG 2 cut(s) 44, 149
EcoICRI GAGCTC 1 cut(s) 57
EcoT38I GRGCYC 1 cut(s) 59
Esp3I CGTCTC 1 cut(s) 221
FaiI YATR 1 cut(s) 177
FauI CCCGC 1 cut(s) 117
Fnu4HI GCNGC 1 cut(s) 146
FokI GGATG 1 cut(s) 167
FriOI GRGCYC 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 146
GluI GCNGC 1 cut(s) 146
HaeIII GGCC 2 cut(s) 83, 159
HapII CCGG 1 cut(s) 27
HinfI GANTC 2 cut(s) 105, 191
HpaII CCGG 1 cut(s) 27
HphI GGTGA 1 cut(s) 31
Hpy188I TCNGA 3 cut(s) 61, 186, 236
Hpy188III TCNNGA 1 cut(s) 52
HpyAV CCTTC 2 cut(s) 181, 221
HpyCH4IV ACGT 1 cut(s) 75
HpyCH4V TGCA 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpySE526I ACGT 1 cut(s) 75
KspI CCGCGG 1 cut(s) 223
Kzo9I GATC 3 cut(s) 6, 66, 87
LpnPI CCDG 4 cut(s) 40, 123, 126, 131
Lsp1109I GCAGC 1 cut(s) 157
MaeII ACGT 1 cut(s) 75
MalI GATC 3 cut(s) 8, 68, 89
MboI GATC 3 cut(s) 6, 66, 87
MboII GAAGA 1 cut(s) 124
MflI RGATCY 2 cut(s) 6, 87
MhlI GDGCHC 1 cut(s) 59
MnlI CCTC 5 cut(s) 40, 53, 94, 117, 145
MseI TTAA 1 cut(s) 23
MspA1I CMGCKG 1 cut(s) 222
MspI CCGG 1 cut(s) 27
MvnI CGCG 1 cut(s) 222
MwoI GCNNNNNNNGC 1 cut(s) 118
NdeII GATC 3 cut(s) 6, 66, 87
PaeR7I CTCGAG 2 cut(s) 44, 149
PfeI GAWTC 2 cut(s) 105, 191
PflFI GACNNNGTC 1 cut(s) 74
PkrI GCNGC 1 cut(s) 147
Ple19I CGATCG 1 cut(s) 69
PsiI TTATAA 1 cut(s) 177
Psp124BI GAGCTC 1 cut(s) 59
PspXI VCTCGAGB 2 cut(s) 44, 149
PsuI RGATCY 2 cut(s) 6, 87
PsyI GACNNNGTC 1 cut(s) 74
PvuI CGATCG 1 cut(s) 69
SacI GAGCTC 1 cut(s) 59
SacII CCGCGG 1 cut(s) 223
SaqAI TTAA 1 cut(s) 23
SatI GCNGC 1 cut(s) 146
Sau3AI GATC 3 cut(s) 6, 66, 87
SduI GDGCHC 1 cut(s) 59
SetI ASST 6 cut(s) 23, 51, 59, 78, 150, 207
Sfr274I CTCGAG 2 cut(s) 44, 149
Sfr303I CCGCGG 1 cut(s) 223
SgrBI CCGCGG 1 cut(s) 223
SlaI CTCGAG 2 cut(s) 44, 149
SmlI CTYRAG 2 cut(s) 44, 149
SmoI CTYRAG 2 cut(s) 44, 149
SsiI CCGC 3 cut(s) 110, 220, 222
SspI AATATT 1 cut(s) 181
SstI GAGCTC 1 cut(s) 59
TaiI ACGT 1 cut(s) 78
TaqI TCGA 4 cut(s) 45, 51, 69, 150
TfiI GAWTC 2 cut(s) 105, 191
Tru1I TTAA 1 cut(s) 23
Tru9I TTAA 1 cut(s) 23
TseI GCWGC 1 cut(s) 145
Tth111I GACNNNGTC 1 cut(s) 74
XhoI CTCGAG 2 cut(s) 44, 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.