RchiOBHm_Chr3g0485591

Flavin containing amine oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Reverse (-)
32327155 .. 32327522
368 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 261 bp
ATGACAGGCAAAGGTGGATTGTGTTGTGCTGGGTTATTAGCTAGGTATCAGCAAGATGTTCTTGTCTTAGAGAGTCGTGATCTACCTGGCGGTGTTGCTCATTCATTTGAGATTAAAGGATTTCAATTTGACTCCTGCCCATCTTTGTTATCTGGTTTTCAATTAAAAGGCCCTCAGGCCAATCCTCTTGGACAAGGGCTCTCTTGGTATCTTGAACTTATAAATGTTGCTGTATTTGGAATTTGCTCTTCAAACTGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.12

Weight (kDa)

5.56

Isoelectric Point (pI)

30.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_8 PF13450 3 - 53 4.6e-10 NAD(P)-binding Rossmann-like domain
Amino_oxidase PF01593 6 - 52 7.1e-06 Flavin containing amine oxidoreductase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018987)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 221
AciI CCGC 1 cut(s) 90
AcsI RAATTY 1 cut(s) 240
AgsI TTSAA 4 cut(s) 125, 161, 215, 252
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
AoxI GGCC 2 cut(s) 169, 177
ApoI RAATTY 1 cut(s) 240
AspS9I GGNCC 1 cut(s) 170
AxyI CCTNAGG 1 cut(s) 174
BanII GRGCYC 1 cut(s) 201
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 1 cut(s) 87
BfaI CTAG 1 cut(s) 42
Bme1390I CCNGG 1 cut(s) 87
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 87
Bse21I CCTNAGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 188
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 2 cut(s) 171, 179
BsnI GGCC 2 cut(s) 171, 179
Bsp1286I GDGCHC 1 cut(s) 201
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 1 cut(s) 90
BspANI GGCC 2 cut(s) 171, 179
BspCNI CTCAG 1 cut(s) 187
BspQI GCTCTTC 1 cut(s) 253
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 87
Bst4CI ACNGT 1 cut(s) 257
Bst6I CTCTTC 1 cut(s) 253
BstDEI CTNAG 2 cut(s) 67, 174
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
Bsu36I CCTNAGG 1 cut(s) 174
BsuRI GGCC 2 cut(s) 171, 179
Cfr13I GGNCC 1 cut(s) 170
CviJI RGCY 4 cut(s) 41, 171, 179, 199
CviKI_1 RGCY 4 cut(s) 41, 171, 179, 199
DdeI CTNAG 2 cut(s) 67, 174
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eam1104I CTCTTC 1 cut(s) 253
EarI CTCTTC 1 cut(s) 253
Eco24I GRGCYC 1 cut(s) 201
Eco81I CCTNAGG 1 cut(s) 174
EcoO109I RGGNCCY 1 cut(s) 170
EcoRII CCWGG 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 201
FaiI YATR 1 cut(s) 221
FalI AAGNNNNNCTT 2 cut(s) 45, 77
FriOI GRGCYC 1 cut(s) 201
FspBI CTAG 1 cut(s) 42
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 2 cut(s) 171, 179
HinfI GANTC 2 cut(s) 73, 131
Hpy188III TCNNGA 2 cut(s) 77, 212
HpyCH4III ACNGT 1 cut(s) 257
HpyF3I CTNAG 2 cut(s) 67, 174
Kzo9I GATC 1 cut(s) 79
LguI GCTCTTC 1 cut(s) 253
LpnPI CCDG 6 cut(s) 15, 72, 99, 138, 148, 161
MaeI CTAG 1 cut(s) 42
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MboII GAAGA 1 cut(s) 240
MhlI GDGCHC 1 cut(s) 201
MluCI AATT 3 cut(s) 125, 161, 240
MlyI GAGTC 2 cut(s) 82, 125
MnlI CCTC 2 cut(s) 183, 195
MseI TTAA 2 cut(s) 114, 164
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
NdeII GATC 1 cut(s) 79
PciSI GCTCTTC 1 cut(s) 253
PleI GAGTC 2 cut(s) 81, 125
PpsI GAGTC 2 cut(s) 81, 125
PsiI TTATAA 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 85
PspFI CCCAGC 1 cut(s) 29
PspGI CCWGG 1 cut(s) 85
PspPI GGNCC 1 cut(s) 170
SapI GCTCTTC 1 cut(s) 253
SaqAI TTAA 2 cut(s) 114, 164
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 1 cut(s) 170
SchI GAGTC 2 cut(s) 82, 125
ScrFI CCNGG 1 cut(s) 87
SduI GDGCHC 1 cut(s) 201
SetI ASST 4 cut(s) 16, 43, 47, 88
Sse9I AATT 3 cut(s) 125, 161, 240
SsiI CCGC 1 cut(s) 90
SspMI CTAG 1 cut(s) 42
StyD4I CCNGG 1 cut(s) 85
TaaI ACNGT 1 cut(s) 257
TasI AATT 3 cut(s) 125, 161, 240
Tru1I TTAA 2 cut(s) 114, 164
Tru9I TTAA 2 cut(s) 114, 164
TspDTI ATGAA 1 cut(s) 93
XapI RAATTY 1 cut(s) 240
XspI CTAG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.