Rh3AG268600

Flavin containing amine oxidoreductase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
30589848 .. 30593133
3286 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG268600.1

Sequence Viewer

Length: 330 bp
ATGACAGGCAAAGGTGGATTGTGTTGTGCTGGGTTATTAGCTAGGTATCAGCAAGATGTTCTTGTCTTAGAGAGTCGTGATCTACCTGGCGGTGTTGCTCATTCATTTGAGATTAAAGGATTTCAATTTGACTCCTGCCCATCTTTGTTATCTGGTTTTCAATTAAAAGGCCCTCAGGCCAATCCTCTTGGACAAGTAACTTGTTCTTTCATTTTTCTTTTCTTACTTTTAAGTCATGATTTTATGGACCTACTTTTAGTGTTACTCAAGTATTACTCGAGATTATATTTCAGTATTACTAGGGGCTCTCTTGGTATCTTGAACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

11.99

Weight (kDa)

7.67

Isoelectric Point (pI)

25.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAD_binding_8 PF13450 3 - 53 9.3e-10 NAD(P)-binding Rossmann-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018987)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 328
AciI CCGC 1 cut(s) 90
AgsI TTSAA 3 cut(s) 125, 161, 322
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 41
AluI AGCT 1 cut(s) 41
Ama87I CYCGRG 1 cut(s) 277
AoxI GGCC 2 cut(s) 169, 177
AspS9I GGNCC 2 cut(s) 170, 247
AvaI CYCGRG 1 cut(s) 277
AvaII GGWCC 1 cut(s) 247
AxyI CCTNAGG 1 cut(s) 174
BanII GRGCYC 1 cut(s) 308
BccI CCATC 1 cut(s) 148
BciT130I CCWGG 1 cut(s) 87
BfaI CTAG 2 cut(s) 42, 300
Bme1390I CCNGG 1 cut(s) 87
Bme18I GGWCC 1 cut(s) 247
BmeT110I CYCGRG 1 cut(s) 277
BmgT120I GGNCC 2 cut(s) 170, 247
BmrFI CCNGG 1 cut(s) 87
BpuEI CTTGAG 1 cut(s) 251
Bse21I CCTNAGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 87
BseMII CTCAG 1 cut(s) 188
BseYI CCCAGC 1 cut(s) 29
BshFI GGCC 2 cut(s) 171, 179
BsiHKCI CYCGRG 1 cut(s) 277
BsnI GGCC 2 cut(s) 171, 179
BsoBI CYCGRG 1 cut(s) 277
Bsp1286I GDGCHC 1 cut(s) 308
Bsp143I GATC 1 cut(s) 79
BspACI CCGC 1 cut(s) 90
BspANI GGCC 2 cut(s) 171, 179
BspCNI CTCAG 1 cut(s) 187
BspHI TCATGA 1 cut(s) 235
BssMI GATC 1 cut(s) 79
Bst2UI CCWGG 1 cut(s) 87
BstDEI CTNAG 2 cut(s) 67, 174
BstKTI GATC 1 cut(s) 82
BstMBI GATC 1 cut(s) 79
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
Bsu36I CCTNAGG 1 cut(s) 174
BsuRI GGCC 2 cut(s) 171, 179
CciI TCATGA 1 cut(s) 235
Cfr13I GGNCC 2 cut(s) 170, 247
CviAII CATG 1 cut(s) 236
CviJI RGCY 4 cut(s) 41, 171, 179, 306
CviKI_1 RGCY 4 cut(s) 41, 171, 179, 306
DdeI CTNAG 2 cut(s) 67, 174
DpnI GATC 1 cut(s) 81
DpnII GATC 1 cut(s) 79
Eco24I GRGCYC 1 cut(s) 308
Eco47I GGWCC 1 cut(s) 247
Eco81I CCTNAGG 1 cut(s) 174
Eco88I CYCGRG 1 cut(s) 277
EcoO109I RGGNCCY 1 cut(s) 170
EcoRII CCWGG 1 cut(s) 85
EcoT38I GRGCYC 1 cut(s) 308
FaeI CATG 1 cut(s) 239
FaiI YATR 4 cut(s) 237, 245, 286, 328
FalI AAGNNNNNCTT 2 cut(s) 45, 77
FatI CATG 1 cut(s) 235
FriOI GRGCYC 1 cut(s) 308
FspBI CTAG 2 cut(s) 42, 300
GsaI CCCAGC 1 cut(s) 33
HaeIII GGCC 2 cut(s) 171, 179
Hin1II CATG 1 cut(s) 239
HinfI GANTC 2 cut(s) 73, 131
Hpy188III TCNNGA 4 cut(s) 77, 236, 279, 319
HpyF3I CTNAG 2 cut(s) 67, 174
Hsp92II CATG 1 cut(s) 239
Kzo9I GATC 1 cut(s) 79
LpnPI CCDG 6 cut(s) 15, 72, 99, 138, 148, 161
MaeI CTAG 2 cut(s) 42, 300
MaeIII GTNAC 2 cut(s) 196, 261
MalI GATC 1 cut(s) 81
MboI GATC 1 cut(s) 79
MhlI GDGCHC 1 cut(s) 308
MluCI AATT 2 cut(s) 125, 161
MlyI GAGTC 2 cut(s) 82, 125
MnlI CCTC 2 cut(s) 183, 195
MseI TTAA 3 cut(s) 114, 164, 230
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
NdeII GATC 1 cut(s) 79
NlaIII CATG 1 cut(s) 239
PaeR7I CTCGAG 1 cut(s) 277
PagI TCATGA 1 cut(s) 235
PleI GAGTC 2 cut(s) 81, 125
PpsI GAGTC 2 cut(s) 81, 125
PsiI TTATAA 1 cut(s) 328
Psp6I CCWGG 1 cut(s) 85
PspFI CCCAGC 1 cut(s) 29
PspGI CCWGG 1 cut(s) 85
PspPI GGNCC 2 cut(s) 170, 247
SaqAI TTAA 3 cut(s) 114, 164, 230
Sau3AI GATC 1 cut(s) 79
Sau96I GGNCC 2 cut(s) 170, 247
SchI GAGTC 2 cut(s) 82, 125
ScrFI CCNGG 1 cut(s) 87
SduI GDGCHC 1 cut(s) 308
SetI ASST 5 cut(s) 16, 43, 47, 88, 252
Sfr274I CTCGAG 1 cut(s) 277
SinI GGWCC 1 cut(s) 247
SlaI CTCGAG 1 cut(s) 277
SmlI CTYRAG 2 cut(s) 266, 277
SmoI CTYRAG 2 cut(s) 266, 277
Sse9I AATT 2 cut(s) 125, 161
SsiI CCGC 1 cut(s) 90
SspMI CTAG 2 cut(s) 42, 300
StyD4I CCNGG 1 cut(s) 85
TaqI TCGA 1 cut(s) 278
TasI AATT 2 cut(s) 125, 161
Tru1I TTAA 3 cut(s) 114, 164, 230
Tru9I TTAA 3 cut(s) 114, 164, 230
TspDTI ATGAA 2 cut(s) 93, 199
VpaK11BI GGWCC 1 cut(s) 247
XhoI CTCGAG 1 cut(s) 277
XspI CTAG 2 cut(s) 42, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.