RchiOBHm_Chr2g0092851

Binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
6244615 .. 6245022
408 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 315 bp
ATGGCTACACCAAGTACATTTACCTACAGCGATTACGTGGACCAACATTTAATGAAAGAAAACGTCCTCAGCGAGGCAGCAATTGCAGGACACCAAGGCGAAATCTGGGCCCAGACCAGTGGGTTCCCTAGATTTCCTGATGCGGAAATTCGGAACATCATGCAAGAATTCGATAAACCTGGGACGCACAGGGTGTTGTCCTGTGGAGGGACTGACCATGTGGTAGTCCAATCCATTCCTCGTATTTTAATTCGCGCACAGCTGCCCGTGAGAATTAAATTTGCTCAAACACCTACAGTCCTACTAGCTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

104

Amino Acids

11.55

Weight (kDa)

6.39

Isoelectric Point (pI)

35.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Profilin PF00235 9 - 86 1.1e-10 Profilin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 255
AciI CCGC 1 cut(s) 143
AcsI RAATTY 3 cut(s) 147, 167, 278
AdeI CACNNNGTG 1 cut(s) 193
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 2 cut(s) 73, 207
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 2 cut(s) 262, 308
AluI AGCT 2 cut(s) 262, 308
AoxI GGCC 1 cut(s) 108
ApaI GGGCCC 1 cut(s) 112
ApeKI GCWGC 2 cut(s) 77, 262
ApoI RAATTY 3 cut(s) 147, 167, 278
AspLEI GCGC 1 cut(s) 257
AspS9I GGNCC 3 cut(s) 40, 108, 109
AvaII GGWCC 1 cut(s) 40
BaeGI GKGCMC 1 cut(s) 112
BanII GRGCYC 1 cut(s) 112
BbvCI CCTCAGC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 89, 249
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 2 cut(s) 129, 305
BfmI CTRYAG 2 cut(s) 25, 294
BisI GCNGC 2 cut(s) 78, 263
BlsI GCNGC 2 cut(s) 79, 264
Bme1390I CCNGG 1 cut(s) 180
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 3 cut(s) 40, 108, 109
BmiI GGNNCC 2 cut(s) 110, 125
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 1 cut(s) 130
Bpu10I CCTNAGC 1 cut(s) 68
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 2 cut(s) 94, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 207
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 2 cut(s) 94, 179
BseLI CCNNNNNNNGG 2 cut(s) 73, 207
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 117
BseSI GKGCMC 1 cut(s) 112
BseXI GCAGC 2 cut(s) 89, 249
Bsh1236I CGCG 1 cut(s) 255
BshFI GGCC 1 cut(s) 110
BslFI GGGAC 2 cut(s) 196, 223
BslI CCNNNNNNNGG 2 cut(s) 73, 207
BsmFI GGGAC 2 cut(s) 196, 223
BsnI GGCC 1 cut(s) 110
Bsp120I GGGCCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 112
BspACI CCGC 1 cut(s) 143
BspANI GGCC 1 cut(s) 110
BspCNI CTCAG 1 cut(s) 81
BspFNI CGCG 1 cut(s) 255
BspHI TCATGA 1 cut(s) 311
BspLI GGNNCC 2 cut(s) 110, 125
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 94, 179
BssT1I CCWWGG 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 298
BstAPI GCANNNNNTGC 1 cut(s) 83
BstBAI YACGTR 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 68
BstENI CCTNNNNNAGG 1 cut(s) 71
BstFNI CGCG 1 cut(s) 255
BstHHI GCGC 1 cut(s) 257
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstSFI CTRYAG 2 cut(s) 25, 294
BstSLI GKGCMC 1 cut(s) 112
BstUI CGCG 1 cut(s) 255
BstV1I GCAGC 2 cut(s) 89, 249
BstXI CCANNNNNNTGG 1 cut(s) 119
BsuRI GGCC 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 124
CciI TCATGA 1 cut(s) 311
CfoI GCGC 1 cut(s) 257
Cfr13I GGNCC 3 cut(s) 40, 108, 109
CseI GACGC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 15
CviAII CATG 3 cut(s) 160, 218, 312
CviJI RGCY 4 cut(s) 5, 110, 262, 308
CviKI_1 RGCY 4 cut(s) 5, 110, 262, 308
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 1 cut(s) 68
DraIII CACNNNGTG 1 cut(s) 193
Eco130I CCWWGG 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 40
EcoNI CCTNNNNNAGG 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 178
EcoT14I CCWWGG 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 112
ErhI CCWWGG 1 cut(s) 94
FaeI CATG 3 cut(s) 163, 221, 315
FaiI YATR 3 cut(s) 161, 219, 313
FaqI GGGAC 2 cut(s) 196, 223
FatI CATG 3 cut(s) 159, 217, 311
Fnu4HI GCNGC 2 cut(s) 78, 263
FriOI GRGCYC 1 cut(s) 112
Fsp4HI GCNGC 2 cut(s) 78, 263
FspBI CTAG 2 cut(s) 129, 305
GlaI GCGC 1 cut(s) 256
GluI GCNGC 2 cut(s) 78, 263
HaeIII GGCC 1 cut(s) 110
HgaI GACGC 1 cut(s) 193
HhaI GCGC 1 cut(s) 257
Hin1II CATG 3 cut(s) 163, 221, 315
Hin6I GCGC 1 cut(s) 255
HinP1I GCGC 1 cut(s) 255
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 2 cut(s) 137, 312
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 298
HpyCH4IV ACGT 2 cut(s) 36, 63
HpyCH4V TGCA 2 cut(s) 86, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 2 cut(s) 36, 63
Hsp92II CATG 3 cut(s) 163, 221, 315
HspAI GCGC 1 cut(s) 255
LpnPI CCDG 9 cut(s) 72, 91, 125, 130, 150, 165, 175, 192, 214
Lsp1109I GCAGC 2 cut(s) 89, 249
LweI GCATC 1 cut(s) 130
MaeI CTAG 2 cut(s) 129, 305
MaeII ACGT 2 cut(s) 36, 63
MfeI CAATTG 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 112
MluCI AATT 6 cut(s) 81, 147, 167, 249, 273, 278
MnlI CCTC 4 cut(s) 67, 77, 200, 249
MseI TTAA 3 cut(s) 50, 248, 276
MspA1I CMGCKG 1 cut(s) 262
MspR9I CCNGG 1 cut(s) 180
MunI CAATTG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 180
MvnI CGCG 1 cut(s) 255
MwoI GCNNNNNNNGC 1 cut(s) 83
NlaIII CATG 3 cut(s) 163, 221, 315
NlaIV GGNNCC 2 cut(s) 110, 125
PagI TCATGA 1 cut(s) 311
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PkrI GCNGC 2 cut(s) 79, 264
Ppu21I YACGTR 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 110, 125
PspOMI GGGCCC 1 cut(s) 108
PspPI GGNCC 3 cut(s) 40, 108, 109
PvuII CAGCTG 1 cut(s) 262
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SaqAI TTAA 3 cut(s) 50, 248, 276
SatI GCNGC 2 cut(s) 78, 263
Sau96I GGNCC 3 cut(s) 40, 108, 109
ScrFI CCNGG 1 cut(s) 180
SduI GDGCHC 1 cut(s) 112
SetI ASST 7 cut(s) 26, 39, 66, 181, 264, 295, 310
SfaNI GCATC 1 cut(s) 130
SfcI CTRYAG 2 cut(s) 25, 294
SinI GGWCC 1 cut(s) 40
Sse9I AATT 6 cut(s) 81, 147, 167, 249, 273, 278
SsiI CCGC 1 cut(s) 143
SspMI CTAG 2 cut(s) 129, 305
StyD4I CCNGG 1 cut(s) 178
StyI CCWWGG 1 cut(s) 94
TaaI ACNGT 1 cut(s) 298
TaiI ACGT 2 cut(s) 39, 66
TaqI TCGA 1 cut(s) 171
TasI AATT 6 cut(s) 81, 147, 167, 249, 273, 278
TatI WGTACW 1 cut(s) 14
Tru1I TTAA 3 cut(s) 50, 248, 276
Tru9I TTAA 3 cut(s) 50, 248, 276
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 77, 262
TspDTI ATGAA 2 cut(s) 68, 300
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 40
XagI CCTNNNNNAGG 1 cut(s) 71
XapI RAATTY 3 cut(s) 147, 167, 278
XspI CTAG 2 cut(s) 129, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.