Rh2BG076000

Binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0017423
Physical Location & Seq
Reverse (-)
5784608 .. 5785015
408 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG076000.1

Sequence Viewer

Length: 315 bp
ATGGCTACACCAAGTACATTTACCTACAGCGATTACGTGGACCAACATTTAATGAAAGAAAACGTCCTCAGCGAGGCAGCAATTGCAGGACACCGAGGCGAAATTTGGGCCCAGACCAGTGGGTTCCCTAGATTTCCTGATGCGGAAATTCGGAACATCATGCAAGAATTCGATCAACCTGGGACGCACAGGGTGTTGTCCTGTGGAGGGACTGACCATGTGGTAGTCCAATCCATTCCTCGTATTTTAATTCGCACACAGCTGCCGGTGAGAATTAAATTTGCTCAAACACCTACAGTCCTACTAGCTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04013 ko04015 ko04810 ko05131 ko05132 map04013 map04015 map04810 map05131 map05132
Pfam Domains
Protein Families
Profilin

Protein Analysis

104

Amino Acids

11.61

Weight (kDa)

6.39

Isoelectric Point (pI)

37.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Profilin PF00235 9 - 85 2.9e-10 Profilin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 143
AcsI RAATTY 4 cut(s) 102, 147, 167, 278
AdeI CACNNNGTG 1 cut(s) 193
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 2 cut(s) 73, 207
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 2 cut(s) 262, 308
AluI AGCT 2 cut(s) 262, 308
AoxI GGCC 1 cut(s) 108
ApaI GGGCCC 1 cut(s) 112
ApeKI GCWGC 2 cut(s) 77, 262
ApoI RAATTY 4 cut(s) 102, 147, 167, 278
AspS9I GGNCC 3 cut(s) 40, 108, 109
AsuHPI GGTGA 1 cut(s) 280
AvaII GGWCC 1 cut(s) 40
BaeGI GKGCMC 1 cut(s) 112
BanII GRGCYC 1 cut(s) 112
BbvCI CCTCAGC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 89, 249
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 2 cut(s) 129, 305
BfmI CTRYAG 2 cut(s) 25, 294
BisI GCNGC 2 cut(s) 78, 263
BlsI GCNGC 2 cut(s) 79, 264
Bme1390I CCNGG 1 cut(s) 180
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 3 cut(s) 40, 108, 109
BmiI GGNNCC 2 cut(s) 110, 125
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 1 cut(s) 130
Bpu10I CCTNAGC 1 cut(s) 68
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 2 cut(s) 94, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 207
Bse118I RCCGGY 1 cut(s) 265
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 2 cut(s) 94, 179
BseLI CCNNNNNNNGG 2 cut(s) 73, 207
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 117
BseSI GKGCMC 1 cut(s) 112
BseXI GCAGC 2 cut(s) 89, 249
BshFI GGCC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 266
BslFI GGGAC 2 cut(s) 196, 223
BslI CCNNNNNNNGG 2 cut(s) 73, 207
BsmFI GGGAC 2 cut(s) 196, 223
BsnI GGCC 1 cut(s) 110
Bsp120I GGGCCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 143
BspANI GGCC 1 cut(s) 110
BspCNI CTCAG 1 cut(s) 81
BspHI TCATGA 1 cut(s) 311
BspLI GGNNCC 2 cut(s) 110, 125
BsrFI RCCGGY 1 cut(s) 265
BsrI ACTGG 1 cut(s) 117
BssAI RCCGGY 1 cut(s) 265
BssECI CCNNGG 2 cut(s) 94, 179
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 180
Bst4CI ACNGT 1 cut(s) 298
BstAPI GCANNNNNTGC 1 cut(s) 83
BstBAI YACGTR 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 68
BstENI CCTNNNNNAGG 1 cut(s) 71
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstSFI CTRYAG 2 cut(s) 25, 294
BstSLI GKGCMC 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 89, 249
BstXI CCANNNNNNTGG 1 cut(s) 119
BsuRI GGCC 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 124
CciI TCATGA 1 cut(s) 311
Cfr10I RCCGGY 1 cut(s) 265
Cfr13I GGNCC 3 cut(s) 40, 108, 109
CseI GACGC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 15
CviAII CATG 3 cut(s) 160, 218, 312
CviJI RGCY 4 cut(s) 5, 110, 262, 308
CviKI_1 RGCY 4 cut(s) 5, 110, 262, 308
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 1 cut(s) 68
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
DraIII CACNNNGTG 1 cut(s) 193
Eco24I GRGCYC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 40
EcoNI CCTNNNNNAGG 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 178
EcoT38I GRGCYC 1 cut(s) 112
FaeI CATG 3 cut(s) 163, 221, 315
FaiI YATR 3 cut(s) 161, 219, 313
FaqI GGGAC 2 cut(s) 196, 223
FatI CATG 3 cut(s) 159, 217, 311
Fnu4HI GCNGC 2 cut(s) 78, 263
FriOI GRGCYC 1 cut(s) 112
Fsp4HI GCNGC 2 cut(s) 78, 263
FspBI CTAG 2 cut(s) 129, 305
GluI GCNGC 2 cut(s) 78, 263
HaeIII GGCC 1 cut(s) 110
HapII CCGG 1 cut(s) 266
HgaI GACGC 1 cut(s) 193
Hin1II CATG 3 cut(s) 163, 221, 315
HpaII CCGG 1 cut(s) 266
HphI GGTGA 1 cut(s) 280
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 2 cut(s) 137, 312
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4III ACNGT 1 cut(s) 298
HpyCH4IV ACGT 2 cut(s) 36, 63
HpyCH4V TGCA 2 cut(s) 86, 163
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 2 cut(s) 36, 63
Hsp92II CATG 3 cut(s) 163, 221, 315
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 9 cut(s) 72, 125, 130, 150, 165, 175, 192, 214, 279
Lsp1109I GCAGC 2 cut(s) 89, 249
LweI GCATC 1 cut(s) 130
MaeI CTAG 2 cut(s) 129, 305
MaeII ACGT 2 cut(s) 36, 63
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MfeI CAATTG 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 112
MluCI AATT 7 cut(s) 81, 102, 147, 167, 249, 273, 278
MnlI CCTC 5 cut(s) 67, 77, 89, 200, 249
MseI TTAA 3 cut(s) 50, 248, 276
MspA1I CMGCKG 1 cut(s) 262
MspI CCGG 1 cut(s) 266
MspR9I CCNGG 1 cut(s) 180
MunI CAATTG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 180
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 1 cut(s) 172
NlaIII CATG 3 cut(s) 163, 221, 315
NlaIV GGNNCC 2 cut(s) 110, 125
PagI TCATGA 1 cut(s) 311
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PkrI GCNGC 2 cut(s) 79, 264
Ppu21I YACGTR 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 110, 125
PspOMI GGGCCC 1 cut(s) 108
PspPI GGNCC 3 cut(s) 40, 108, 109
PvuII CAGCTG 1 cut(s) 262
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SaqAI TTAA 3 cut(s) 50, 248, 276
SatI GCNGC 2 cut(s) 78, 263
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 3 cut(s) 40, 108, 109
ScrFI CCNGG 1 cut(s) 180
SduI GDGCHC 1 cut(s) 112
SetI ASST 7 cut(s) 26, 39, 66, 181, 264, 295, 310
SfaNI GCATC 1 cut(s) 130
SfcI CTRYAG 2 cut(s) 25, 294
SinI GGWCC 1 cut(s) 40
Sse9I AATT 7 cut(s) 81, 102, 147, 167, 249, 273, 278
SsiI CCGC 1 cut(s) 143
SspMI CTAG 2 cut(s) 129, 305
StyD4I CCNGG 1 cut(s) 178
TaaI ACNGT 1 cut(s) 298
TaiI ACGT 2 cut(s) 39, 66
TaqI TCGA 1 cut(s) 171
TasI AATT 7 cut(s) 81, 102, 147, 167, 249, 273, 278
TatI WGTACW 1 cut(s) 14
Tru1I TTAA 3 cut(s) 50, 248, 276
Tru9I TTAA 3 cut(s) 50, 248, 276
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 77, 262
TspDTI ATGAA 2 cut(s) 68, 300
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 40
XagI CCTNNNNNAGG 1 cut(s) 71
XapI RAATTY 4 cut(s) 102, 147, 167, 278
XspI CTAG 2 cut(s) 129, 305
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.