Rroxscaffold_2G00148840

Binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Forward (+)
86459493 .. 86460655
1163 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00148840.1

Sequence Viewer

Length: 399 bp
ATGGCTAGACCAAGAACACTTACCTACAGCGATTACGTGGACCAACATTTAATGAAAGAAAACGTCCTCAGCGAGGCAGCAATTGCTGGACACCAAGGCGAAATTTGGGCCCAGACCAGTGGGTTCCCTAGATTTCCTGATGCGGAAATTCGGAACATCATGCAAGAATTTGATCAACCTGGGACGCACAGGGTGTTGTCCTGTGGAGGGACTGACCATGTAGTTGTCCAAGGCATCCCCCGTATTTTAATTCGCGCACAGCTGCCGGGCACTGATGGAGGCGTTATAATAATGAAGACCATACAACTGCTGCTTATAGGGACCTATAATAGCAACCCTACCCAGTCCAGCACTATTGTTGAAGATTTGGGCAATTTTTTCGTATGCAATGGTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

132

Amino Acids

14.51

Weight (kDa)

5.42

Isoelectric Point (pI)

27.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Profilin PF00235 9 - 130 2.2e-19 Profilin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 287
AccII CGCG 1 cut(s) 255
AciI CCGC 1 cut(s) 143
AcsI RAATTY 3 cut(s) 102, 147, 167
AdeI CACNNNGTG 1 cut(s) 193
AfiI CCNNNNNNNGG 2 cut(s) 73, 207
AgsI TTSAA 1 cut(s) 362
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
AoxI GGCC 1 cut(s) 108
ApaI GGGCCC 1 cut(s) 112
ApeKI GCWGC 3 cut(s) 77, 262, 310
ApoI RAATTY 3 cut(s) 102, 147, 167
AspLEI GCGC 1 cut(s) 257
AspS9I GGNCC 4 cut(s) 40, 108, 109, 321
AsuC2I CCSGG 1 cut(s) 267
AvaII GGWCC 2 cut(s) 40, 321
BaeGI GKGCMC 2 cut(s) 112, 272
BanII GRGCYC 1 cut(s) 112
BbsI GAAGAC 1 cut(s) 302
BbvCI CCTCAGC 1 cut(s) 68
BbvI GCAGC 3 cut(s) 89, 249, 297
BccI CCATC 1 cut(s) 269
BcgI CGANNNNNNTGC 2 cut(s) 361, 395
BciT130I CCWGG 1 cut(s) 180
BclI TGATCA 1 cut(s) 172
BcnI CCSGG 1 cut(s) 267
BfaI CTAG 2 cut(s) 6, 129
BfmI CTRYAG 1 cut(s) 25
BisI GCNGC 3 cut(s) 78, 263, 311
BlsI GCNGC 3 cut(s) 79, 264, 312
Bme1390I CCNGG 2 cut(s) 180, 267
Bme18I GGWCC 2 cut(s) 40, 321
BmgT120I GGNCC 4 cut(s) 40, 108, 109, 321
BmiI GGNNCC 3 cut(s) 110, 125, 322
BmrFI CCNGG 2 cut(s) 180, 267
BmrI ACTGGG 1 cut(s) 337
BmsI GCATC 2 cut(s) 130, 243
BmuI ACTGGG 1 cut(s) 337
BpiI GAAGAC 1 cut(s) 302
Bpu10I CCTNAGC 1 cut(s) 68
BpuMI CCSGG 1 cut(s) 267
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 3 cut(s) 94, 179, 229
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 207
Bse1I ACTGG 2 cut(s) 117, 343
Bse3DI GCAATG 1 cut(s) 394
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 3 cut(s) 94, 179, 229
BseGI GGATG 1 cut(s) 234
BseLI CCNNNNNNNGG 2 cut(s) 73, 207
BseMI GCAATG 1 cut(s) 394
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 2 cut(s) 117, 343
BseSI GKGCMC 2 cut(s) 112, 272
BseXI GCAGC 3 cut(s) 89, 249, 297
Bsh1236I CGCG 1 cut(s) 255
BshFI GGCC 1 cut(s) 110
BsiSI CCGG 1 cut(s) 266
BslFI GGGAC 3 cut(s) 196, 223, 334
BslI CCNNNNNNNGG 2 cut(s) 73, 207
BsmFI GGGAC 3 cut(s) 196, 223, 334
BsnI GGCC 1 cut(s) 110
Bsp120I GGGCCC 1 cut(s) 108
Bsp1286I GDGCHC 2 cut(s) 112, 272
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 1 cut(s) 143
BspANI GGCC 1 cut(s) 110
BspCNI CTCAG 1 cut(s) 81
BspFNI CGCG 1 cut(s) 255
BspLI GGNNCC 3 cut(s) 110, 125, 322
BsrDI GCAATG 1 cut(s) 394
BsrI ACTGG 2 cut(s) 117, 343
BssECI CCNNGG 3 cut(s) 94, 179, 229
BssMI GATC 1 cut(s) 172
BssT1I CCWWGG 2 cut(s) 94, 229
Bst2UI CCWGG 1 cut(s) 180
BstAPI GCANNNNNTGC 1 cut(s) 83
BstBAI YACGTR 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 68
BstENI CCTNNNNNAGG 1 cut(s) 71
BstF5I GGATG 1 cut(s) 234
BstFNI CGCG 1 cut(s) 255
BstHHI GCGC 1 cut(s) 257
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 2 cut(s) 178, 265
BstSFI CTRYAG 1 cut(s) 25
BstSLI GKGCMC 2 cut(s) 112, 272
BstUI CGCG 1 cut(s) 255
BstV1I GCAGC 3 cut(s) 89, 249, 297
BstV2I GAAGAC 1 cut(s) 302
BstXI CCANNNNNNTGG 1 cut(s) 119
BsuRI GGCC 1 cut(s) 110
BtsCI GGATG 1 cut(s) 234
BtsIMutI CAGTG 2 cut(s) 124, 270
CfoI GCGC 1 cut(s) 257
Cfr13I GGNCC 4 cut(s) 40, 108, 109, 321
CseI GACGC 1 cut(s) 193
CviAII CATG 2 cut(s) 160, 218
CviJI RGCY 3 cut(s) 5, 110, 262
CviKI_1 RGCY 3 cut(s) 5, 110, 262
DdeI CTNAG 1 cut(s) 68
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
DraIII CACNNNGTG 1 cut(s) 193
Eco130I CCWWGG 2 cut(s) 94, 229
Eco24I GRGCYC 1 cut(s) 112
Eco47I GGWCC 2 cut(s) 40, 321
EcoNI CCTNNNNNAGG 1 cut(s) 71
EcoO109I RGGNCCY 1 cut(s) 321
EcoRII CCWGG 1 cut(s) 178
EcoT14I CCWWGG 2 cut(s) 94, 229
EcoT38I GRGCYC 1 cut(s) 112
ErhI CCWWGG 2 cut(s) 94, 229
FaeI CATG 2 cut(s) 163, 221
FaiI YATR 7 cut(s) 161, 219, 287, 302, 317, 327, 385
FaqI GGGAC 3 cut(s) 196, 223, 334
FatI CATG 2 cut(s) 159, 217
FbaI TGATCA 1 cut(s) 172
Fnu4HI GCNGC 3 cut(s) 78, 263, 311
FokI GGATG 1 cut(s) 221
FriOI GRGCYC 1 cut(s) 112
Fsp4HI GCNGC 3 cut(s) 78, 263, 311
FspBI CTAG 2 cut(s) 6, 129
GlaI GCGC 1 cut(s) 256
GluI GCNGC 3 cut(s) 78, 263, 311
HaeIII GGCC 1 cut(s) 110
HapII CCGG 1 cut(s) 266
HgaI GACGC 1 cut(s) 193
HhaI GCGC 1 cut(s) 257
Hin1II CATG 2 cut(s) 163, 221
Hin6I GCGC 1 cut(s) 255
HinP1I GCGC 1 cut(s) 255
HpaII CCGG 1 cut(s) 266
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 1 cut(s) 153
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4IV ACGT 2 cut(s) 36, 63
HpyCH4V TGCA 2 cut(s) 163, 387
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 1 cut(s) 68
HpySE526I ACGT 2 cut(s) 36, 63
Hsp92II CATG 2 cut(s) 163, 221
HspAI GCGC 1 cut(s) 255
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 1 cut(s) 172
Lsp1109I GCAGC 3 cut(s) 89, 249, 297
LweI GCATC 2 cut(s) 130, 243
MaeI CTAG 2 cut(s) 6, 129
MaeII ACGT 2 cut(s) 36, 63
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MboII GAAGA 2 cut(s) 307, 374
MfeI CAATTG 1 cut(s) 81
MhlI GDGCHC 2 cut(s) 112, 272
MluCI AATT 6 cut(s) 81, 102, 147, 167, 249, 373
MnlI CCTC 4 cut(s) 67, 77, 200, 272
MseI TTAA 3 cut(s) 50, 248, 397
MspA1I CMGCKG 1 cut(s) 262
MspI CCGG 1 cut(s) 266
MspR9I CCNGG 2 cut(s) 180, 267
MunI CAATTG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 180
MvnI CGCG 1 cut(s) 255
MwoI GCNNNNNNNGC 1 cut(s) 83
NciI CCSGG 1 cut(s) 267
NdeII GATC 1 cut(s) 172
NlaIII CATG 2 cut(s) 163, 221
NlaIV GGNNCC 3 cut(s) 110, 125, 322
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PkrI GCNGC 3 cut(s) 79, 264, 312
Ppu21I YACGTR 1 cut(s) 37
PpuMI RGGWCCY 1 cut(s) 321
PsiI TTATAA 1 cut(s) 287
Psp5II RGGWCCY 1 cut(s) 321
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 3 cut(s) 110, 125, 322
PspOMI GGGCCC 1 cut(s) 108
PspPI GGNCC 4 cut(s) 40, 108, 109, 321
PspPPI RGGWCCY 1 cut(s) 321
PvuII CAGCTG 1 cut(s) 262
SaqAI TTAA 3 cut(s) 50, 248, 397
SatI GCNGC 3 cut(s) 78, 263, 311
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 4 cut(s) 40, 108, 109, 321
ScrFI CCNGG 2 cut(s) 180, 267
SduI GDGCHC 2 cut(s) 112, 272
SetI ASST 6 cut(s) 26, 39, 66, 181, 264, 326
SfaNI GCATC 2 cut(s) 130, 243
SfcI CTRYAG 1 cut(s) 25
SinI GGWCC 2 cut(s) 40, 321
Sse9I AATT 6 cut(s) 81, 102, 147, 167, 249, 373
SsiI CCGC 1 cut(s) 143
SspMI CTAG 2 cut(s) 6, 129
StyD4I CCNGG 2 cut(s) 178, 265
StyI CCWWGG 2 cut(s) 94, 229
TaiI ACGT 2 cut(s) 39, 66
TasI AATT 6 cut(s) 81, 102, 147, 167, 249, 373
Tru1I TTAA 3 cut(s) 50, 248, 397
Tru9I TTAA 3 cut(s) 50, 248, 397
TscAI CASTG 2 cut(s) 124, 277
TseI GCWGC 3 cut(s) 77, 262, 310
TspDTI ATGAA 2 cut(s) 68, 308
TspRI CASTG 2 cut(s) 124, 277
VpaK11BI GGWCC 2 cut(s) 40, 321
XagI CCTNNNNNAGG 1 cut(s) 71
XapI RAATTY 3 cut(s) 102, 147, 167
XspI CTAG 2 cut(s) 6, 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.