Rh2CG078100

Binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
Physical Location & Seq
Reverse (-)
6346922 .. 6349733
2812 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG078100.1

Sequence Viewer

Length: 300 bp
ATGGCTACACCAAGTACATTTACCTACAGCGATTACGTGGACCAACATTTAATGAAAGAAAACGTCCTCAGCGAGGCAGCAATTGCAGGACACCGAGGCGAAATTTGGGCCCAGACCAGTGGGTTCCCTAGATTTCCTGATGCGGAAATTCGGAACATCATGCAAGAATTCGATCAACCTGGGACGCACAGGGTGTTGTCCTGTGGAGGGACTGACCATGTGGTAGTCCAATCCATTCCTCGTATTTTAATTCGCACACAGCTGCCGCTTAGGCATCGGAAAGGAGTCGGAGGAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.06

Weight (kDa)

6.96

Isoelectric Point (pI)

39.85

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Profilin PF00235 9 - 82 3.6e-10 Profilin
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 143, 266
AcsI RAATTY 3 cut(s) 102, 147, 167
AdeI CACNNNGTG 1 cut(s) 193
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 2 cut(s) 73, 207
AjnI CCWGG 1 cut(s) 178
AluBI AGCT 1 cut(s) 262
AluI AGCT 1 cut(s) 262
AoxI GGCC 1 cut(s) 108
ApaI GGGCCC 1 cut(s) 112
ApeKI GCWGC 2 cut(s) 77, 262
ApoI RAATTY 3 cut(s) 102, 147, 167
AspS9I GGNCC 3 cut(s) 40, 108, 109
AvaII GGWCC 1 cut(s) 40
BaeGI GKGCMC 1 cut(s) 112
BanII GRGCYC 1 cut(s) 112
BbvCI CCTCAGC 1 cut(s) 68
BbvI GCAGC 2 cut(s) 89, 249
BciT130I CCWGG 1 cut(s) 180
BfaI CTAG 1 cut(s) 129
BfmI CTRYAG 1 cut(s) 25
BglI GCCNNNNNGGC 1 cut(s) 271
BisI GCNGC 3 cut(s) 78, 263, 266
BlsI GCNGC 3 cut(s) 79, 264, 267
Bme1390I CCNGG 1 cut(s) 180
Bme18I GGWCC 1 cut(s) 40
BmgT120I GGNCC 3 cut(s) 40, 108, 109
BmiI GGNNCC 2 cut(s) 110, 125
BmrFI CCNGG 1 cut(s) 180
BmsI GCATC 2 cut(s) 130, 283
Bpu10I CCTNAGC 2 cut(s) 68, 269
BsaAI YACGTR 1 cut(s) 37
BsaJI CCNNGG 2 cut(s) 94, 179
Bsc4I CCNNNNNNNGG 2 cut(s) 73, 207
Bse1I ACTGG 1 cut(s) 117
BseBI CCWGG 1 cut(s) 180
BseDI CCNNGG 2 cut(s) 94, 179
BseLI CCNNNNNNNGG 2 cut(s) 73, 207
BseMII CTCAG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 117
BseSI GKGCMC 1 cut(s) 112
BseXI GCAGC 2 cut(s) 89, 249
BshFI GGCC 1 cut(s) 110
BslFI GGGAC 2 cut(s) 196, 223
BslI CCNNNNNNNGG 2 cut(s) 73, 207
BsmFI GGGAC 2 cut(s) 196, 223
BsnI GGCC 1 cut(s) 110
Bsp120I GGGCCC 1 cut(s) 108
Bsp1286I GDGCHC 1 cut(s) 112
Bsp143I GATC 1 cut(s) 172
BspACI CCGC 2 cut(s) 143, 266
BspANI GGCC 1 cut(s) 110
BspCNI CTCAG 1 cut(s) 81
BspLI GGNNCC 2 cut(s) 110, 125
BsrI ACTGG 1 cut(s) 117
BssECI CCNNGG 2 cut(s) 94, 179
BssMI GATC 1 cut(s) 172
Bst2UI CCWGG 1 cut(s) 180
BstAPI GCANNNNNTGC 1 cut(s) 83
BstBAI YACGTR 1 cut(s) 37
BstDEI CTNAG 2 cut(s) 68, 269
BstENI CCTNNNNNAGG 1 cut(s) 71
BstKTI GATC 1 cut(s) 175
BstMBI GATC 1 cut(s) 172
BstMWI GCNNNNNNNGC 2 cut(s) 83, 271
BstNI CCWGG 1 cut(s) 180
BstSCI CCNGG 1 cut(s) 178
BstSFI CTRYAG 1 cut(s) 25
BstSLI GKGCMC 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 89, 249
BstXI CCANNNNNNTGG 1 cut(s) 119
BsuRI GGCC 1 cut(s) 110
BtsIMutI CAGTG 1 cut(s) 124
Cfr13I GGNCC 3 cut(s) 40, 108, 109
CseI GACGC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 15
CviAII CATG 2 cut(s) 160, 218
CviJI RGCY 3 cut(s) 5, 110, 262
CviKI_1 RGCY 3 cut(s) 5, 110, 262
CviQI GTAC 1 cut(s) 15
DdeI CTNAG 2 cut(s) 68, 269
DpnI GATC 1 cut(s) 174
DpnII GATC 1 cut(s) 172
DraIII CACNNNGTG 1 cut(s) 193
Eco24I GRGCYC 1 cut(s) 112
Eco47I GGWCC 1 cut(s) 40
EcoNI CCTNNNNNAGG 1 cut(s) 71
EcoRI GAATTC 1 cut(s) 167
EcoRII CCWGG 1 cut(s) 178
EcoT38I GRGCYC 1 cut(s) 112
FaeI CATG 2 cut(s) 163, 221
FaiI YATR 2 cut(s) 161, 219
FaqI GGGAC 2 cut(s) 196, 223
FatI CATG 2 cut(s) 159, 217
Fnu4HI GCNGC 3 cut(s) 78, 263, 266
FriOI GRGCYC 1 cut(s) 112
Fsp4HI GCNGC 3 cut(s) 78, 263, 266
FspBI CTAG 1 cut(s) 129
GluI GCNGC 3 cut(s) 78, 263, 266
HaeIII GGCC 1 cut(s) 110
HgaI GACGC 1 cut(s) 193
Hin1II CATG 2 cut(s) 163, 221
HinfI GANTC 1 cut(s) 285
Hpy166II GTNNAC 1 cut(s) 40
Hpy188I TCNGA 3 cut(s) 153, 279, 290
Hpy188III TCNNGA 1 cut(s) 137
Hpy8I GTNNAC 1 cut(s) 40
HpyCH4IV ACGT 2 cut(s) 36, 63
HpyCH4V TGCA 2 cut(s) 86, 163
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 271
HpyF3I CTNAG 2 cut(s) 68, 269
HpySE526I ACGT 2 cut(s) 36, 63
Hsp92II CATG 2 cut(s) 163, 221
Kzo9I GATC 1 cut(s) 172
LpnPI CCDG 8 cut(s) 72, 125, 130, 150, 165, 175, 192, 214
Lsp1109I GCAGC 2 cut(s) 89, 249
LweI GCATC 2 cut(s) 130, 283
MaeI CTAG 1 cut(s) 129
MaeII ACGT 2 cut(s) 36, 63
MalI GATC 1 cut(s) 174
MboI GATC 1 cut(s) 172
MfeI CAATTG 1 cut(s) 81
MhlI GDGCHC 1 cut(s) 112
MluCI AATT 5 cut(s) 81, 102, 147, 167, 249
MlyI GAGTC 1 cut(s) 294
MmeI TCCRAC 1 cut(s) 268
MnlI CCTC 6 cut(s) 67, 77, 89, 200, 249, 284
MseI TTAA 2 cut(s) 50, 248
MspA1I CMGCKG 1 cut(s) 262
MspR9I CCNGG 1 cut(s) 180
MunI CAATTG 1 cut(s) 81
MvaI CCWGG 1 cut(s) 180
MwoI GCNNNNNNNGC 2 cut(s) 83, 271
NdeII GATC 1 cut(s) 172
NlaIII CATG 2 cut(s) 163, 221
NlaIV GGNNCC 2 cut(s) 110, 125
PcsI WCGNNNNNNNCGW 1 cut(s) 69
PkrI GCNGC 3 cut(s) 79, 264, 267
PleI GAGTC 1 cut(s) 293
PpsI GAGTC 1 cut(s) 293
Ppu21I YACGTR 1 cut(s) 37
Psp6I CCWGG 1 cut(s) 178
PspGI CCWGG 1 cut(s) 178
PspN4I GGNNCC 2 cut(s) 110, 125
PspOMI GGGCCC 1 cut(s) 108
PspPI GGNCC 3 cut(s) 40, 108, 109
PvuII CAGCTG 1 cut(s) 262
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SaqAI TTAA 2 cut(s) 50, 248
SatI GCNGC 3 cut(s) 78, 263, 266
Sau3AI GATC 1 cut(s) 172
Sau96I GGNCC 3 cut(s) 40, 108, 109
SchI GAGTC 1 cut(s) 294
ScrFI CCNGG 1 cut(s) 180
SduI GDGCHC 1 cut(s) 112
SetI ASST 5 cut(s) 26, 39, 66, 181, 264
SfaNI GCATC 2 cut(s) 130, 283
SfcI CTRYAG 1 cut(s) 25
SinI GGWCC 1 cut(s) 40
Sse9I AATT 5 cut(s) 81, 102, 147, 167, 249
SsiI CCGC 2 cut(s) 143, 266
SspMI CTAG 1 cut(s) 129
StyD4I CCNGG 1 cut(s) 178
TaiI ACGT 2 cut(s) 39, 66
TaqI TCGA 1 cut(s) 171
TasI AATT 5 cut(s) 81, 102, 147, 167, 249
TatI WGTACW 1 cut(s) 14
TauI GCSGC 1 cut(s) 268
Tru1I TTAA 2 cut(s) 50, 248
Tru9I TTAA 2 cut(s) 50, 248
TscAI CASTG 1 cut(s) 124
TseI GCWGC 2 cut(s) 77, 262
TspDTI ATGAA 1 cut(s) 68
TspRI CASTG 1 cut(s) 124
VpaK11BI GGWCC 1 cut(s) 40
XagI CCTNNNNNAGG 1 cut(s) 71
XapI RAATTY 3 cut(s) 102, 147, 167
XspI CTAG 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.