RchiOBHm_Chr2g0100621
ERF Family

belongs to the protein kinase superfamily

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
12520802 .. 12521947
1146 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGGGTTTGTTAAAGGTGGAGACTTGGGATGGGAGCAAATCAAAGGGAAGGAAGAAGAAGAAGAAGAAGGATGAGGCTGTCGAGGAAACTGGGTGTTGGATTAAGTTCTCTTTTGGGATTTGCATGCCTTCTTCAAGATCCAAAGTTGATAGCACCATGACTGGGACTACTATATCTTTTGGATGGAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

7.02

Weight (kDa)

9.64

Isoelectric Point (pI)

34.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 162
AgsI TTSAA 1 cut(s) 135
Alw26I GTCTC 1 cut(s) 14
AlwI GGATC 1 cut(s) 132
BccI CCATC 2 cut(s) 23, 177
BcoDI GTCTC 1 cut(s) 14
BmrI ACTGGG 2 cut(s) 99, 171
BmuI ACTGGG 2 cut(s) 99, 171
Bsc4I CCNNNNNNNGG 1 cut(s) 162
Bse1I ACTGG 2 cut(s) 94, 166
BseGI GGATG 3 cut(s) 34, 76, 188
BseLI CCNNNNNNNGG 1 cut(s) 162
BseNI ACTGG 2 cut(s) 94, 166
BslFI GGGAC 1 cut(s) 178
BslI CCNNNNNNNGG 1 cut(s) 162
BsmAI GTCTC 1 cut(s) 14
BsmFI GGGAC 1 cut(s) 178
Bsp143I GATC 1 cut(s) 137
BspPI GGATC 1 cut(s) 132
BsrI ACTGG 2 cut(s) 94, 166
BssMI GATC 1 cut(s) 137
BstC8I GCNNGC 1 cut(s) 125
BstF5I GGATG 3 cut(s) 34, 76, 188
BstKTI GATC 1 cut(s) 140
BstMAI GTCTC 1 cut(s) 14
BstMBI GATC 1 cut(s) 137
BstNSI RCATGY 1 cut(s) 127
BstX2I RGATCY 1 cut(s) 137
BstYI RGATCY 1 cut(s) 137
BtsCI GGATG 3 cut(s) 34, 76, 188
Cac8I GCNNGC 1 cut(s) 125
CviAII CATG 2 cut(s) 124, 157
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
DpnI GATC 1 cut(s) 139
DpnII GATC 1 cut(s) 137
FaeI CATG 2 cut(s) 127, 160
FaiI YATR 3 cut(s) 125, 158, 173
FaqI GGGAC 1 cut(s) 178
FatI CATG 2 cut(s) 123, 156
FokI GGATG 2 cut(s) 41, 83
Hin1II CATG 2 cut(s) 127, 160
Hpy188III TCNNGA 1 cut(s) 135
HpyAV CCTTC 3 cut(s) 42, 61, 138
HpyCH4V TGCA 1 cut(s) 123
Hsp92II CATG 2 cut(s) 127, 160
Kzo9I GATC 1 cut(s) 137
LmnI GCTCC 1 cut(s) 33
LpnPI CCDG 2 cut(s) 75, 147
MalI GATC 1 cut(s) 139
MboI GATC 1 cut(s) 137
MboII GAAGA 6 cut(s) 64, 67, 70, 73, 76, 123
MflI RGATCY 1 cut(s) 137
MmeI TCCRAC 1 cut(s) 77
MnlI CCTC 2 cut(s) 67, 76
MseI TTAA 3 cut(s) 11, 102, 190
NdeII GATC 1 cut(s) 137
NlaIII CATG 2 cut(s) 127, 160
NspI RCATGY 1 cut(s) 127
PaeI GCATGC 1 cut(s) 127
PsuI RGATCY 1 cut(s) 137
SaqAI TTAA 3 cut(s) 11, 102, 190
Sau3AI GATC 1 cut(s) 137
SetI ASST 1 cut(s) 18
SgeI CNNG 7 cut(s) 36, 94, 102, 136, 147, 169, 174
SphI GCATGC 1 cut(s) 127
TaqI TCGA 1 cut(s) 81
Tru1I TTAA 3 cut(s) 11, 102, 190
Tru9I TTAA 3 cut(s) 11, 102, 190
XceI RCATGY 1 cut(s) 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.