Rh1CG020500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Forward (+)
3418785 .. 3420129
1345 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG020500.1

Sequence Viewer

Length: 228 bp
ATGTCTTGGGGGAGGATATGCACAACCCTGGATTTTGGTCAAGGGTTTGCCTTCATAACATTGCCAAGACAGAACAGGCATTTCATTTTGTTCATCTTAATTAAGCATCTTGATCACAAGAATAAAAGAAAAAAACTTACCTTCCTCTCTGATCATACGAACACCGATTATCCAAGCCTCTGGGTTACCTCCGCTTTGAGTACGCAAAGTTCTCGTAAGATGACTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.8

Weight (kDa)

10.38

Isoelectric Point (pI)

53.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 192
AfaI GTAC 1 cut(s) 202
AjnI CCWGG 1 cut(s) 27
BcgI CGANNNNNNTGC 2 cut(s) 194, 228
BciT130I CCWGG 1 cut(s) 29
BclI TGATCA 2 cut(s) 112, 151
Bme1390I CCNGG 1 cut(s) 29
BmrFI CCNGG 1 cut(s) 29
BmsI GCATC 1 cut(s) 115
BsaJI CCNNGG 1 cut(s) 27
Bse3DI GCAATG 1 cut(s) 59
BseBI CCWGG 1 cut(s) 29
BseDI CCNNGG 1 cut(s) 27
BseMI GCAATG 1 cut(s) 59
Bsp143I GATC 2 cut(s) 112, 151
BspACI CCGC 1 cut(s) 192
BsrDI GCAATG 1 cut(s) 59
BssECI CCNNGG 1 cut(s) 27
BssMI GATC 2 cut(s) 112, 151
Bst2UI CCWGG 1 cut(s) 29
BstEII GGTNACC 1 cut(s) 184
BstKTI GATC 2 cut(s) 115, 154
BstMBI GATC 2 cut(s) 112, 151
BstNI CCWGG 1 cut(s) 29
BstPI GGTNACC 1 cut(s) 184
BstSCI CCNGG 1 cut(s) 27
BstXI CCANNNNNNTGG 1 cut(s) 180
Csp6I GTAC 1 cut(s) 201
CviJI RGCY 1 cut(s) 177
CviKI_1 RGCY 1 cut(s) 177
CviQI GTAC 1 cut(s) 201
DpnI GATC 2 cut(s) 114, 153
DpnII GATC 2 cut(s) 112, 151
Eco91I GGTNACC 1 cut(s) 184
EcoO65I GGTNACC 1 cut(s) 184
EcoRII CCWGG 1 cut(s) 27
FaiI YATR 3 cut(s) 19, 56, 156
FbaI TGATCA 2 cut(s) 112, 151
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 1 cut(s) 110
HpyAV CCTTC 2 cut(s) 61, 151
HpyCH4V TGCA 1 cut(s) 21
Ksp22I TGATCA 2 cut(s) 112, 151
Kzo9I GATC 2 cut(s) 112, 151
LpnPI CCDG 4 cut(s) 14, 41, 61, 166
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 184
MalI GATC 2 cut(s) 114, 153
MboI GATC 2 cut(s) 112, 151
MluCI AATT 1 cut(s) 99
MnlI CCTC 4 cut(s) 6, 155, 188, 199
MseI TTAA 2 cut(s) 98, 102
MspR9I CCNGG 1 cut(s) 29
MvaI CCWGG 1 cut(s) 29
NdeII GATC 2 cut(s) 112, 151
PacI TTAATTAA 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 27
PspEI GGTNACC 1 cut(s) 184
PspGI CCWGG 1 cut(s) 27
PsrI GAACNNNNNNTAC 2 cut(s) 193, 225
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
SaqAI TTAA 2 cut(s) 98, 102
Sau3AI GATC 2 cut(s) 112, 151
ScrFI CCNGG 1 cut(s) 29
SetI ASST 2 cut(s) 143, 191
SfaNI GCATC 1 cut(s) 115
Sse9I AATT 1 cut(s) 99
SsiI CCGC 1 cut(s) 192
StyD4I CCNGG 1 cut(s) 27
TasI AATT 1 cut(s) 99
Tru1I TTAA 2 cut(s) 98, 102
Tru9I TTAA 2 cut(s) 98, 102
TspDTI ATGAA 3 cut(s) 43, 73, 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.