Rh7CG449800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
59186386 .. 59201559
15174 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG449800.1

Sequence Viewer

Length: 285 bp
ATGGCAATATACCAAATTCACATTCCCTCTAATCATATTCACTACATCAAACCTAATATTCGTTTTAGTCGGCAGAAAGGAAAAAAACCTGTGTTCCTCTCTAATCATACGAACACCCATTGTCCATCCATCACTGATATTGTCATCTTTTCCATAGTCTTCTTCCGCTGCTCTTTAGTGGTTATGTTATTGCCAAGCCTCCGAGTTACTGCCGCTTTGAGTACGCAAAGTTCTCGTAAGTTGAAACTATTTCCTTTGACTGATCGTGAAAAAGCTCGCAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

94

Amino Acids

10.83

Weight (kDa)

10.76

Isoelectric Point (pI)

48.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 166, 213
AcsI RAATTY 1 cut(s) 15
AfaI GTAC 1 cut(s) 223
AgsI TTSAA 1 cut(s) 244
AjuI GAANNNNNNNTTGG 1 cut(s) 38
AluBI AGCT 1 cut(s) 275
AluI AGCT 1 cut(s) 275
ApeKI GCWGC 1 cut(s) 168
ApoI RAATTY 1 cut(s) 15
BbsI GAAGAC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 155
BccI CCATC 2 cut(s) 133, 137
BcgI CGANNNNNNTGC 2 cut(s) 215, 249
BfaI CTAG 1 cut(s) 283
BisI GCNGC 2 cut(s) 169, 213
BlsI GCNGC 2 cut(s) 170, 214
BpiI GAAGAC 1 cut(s) 151
BseGI GGATG 1 cut(s) 125
BseXI GCAGC 1 cut(s) 155
Bsp143I GATC 1 cut(s) 262
BspACI CCGC 2 cut(s) 166, 213
BssMI GATC 1 cut(s) 262
BstC8I GCNNGC 1 cut(s) 277
BstF5I GGATG 1 cut(s) 125
BstKTI GATC 1 cut(s) 265
BstMBI GATC 1 cut(s) 262
BstV1I GCAGC 1 cut(s) 155
BstV2I GAAGAC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 125
BtsIMutI CAGTG 1 cut(s) 132
Cac8I GCNNGC 1 cut(s) 277
Csp6I GTAC 1 cut(s) 222
CviJI RGCY 2 cut(s) 198, 275
CviKI_1 RGCY 2 cut(s) 198, 275
CviQI GTAC 1 cut(s) 222
DpnI GATC 1 cut(s) 264
DpnII GATC 1 cut(s) 262
FaiI YATR 5 cut(s) 10, 36, 108, 155, 185
Fnu4HI GCNGC 2 cut(s) 169, 213
FokI GGATG 1 cut(s) 112
Fsp4HI GCNGC 2 cut(s) 169, 213
FspBI CTAG 1 cut(s) 283
GluI GCNGC 2 cut(s) 169, 213
Hpy188I TCNGA 1 cut(s) 203
Hpy188III TCNNGA 1 cut(s) 266
Kzo9I GATC 1 cut(s) 262
LpnPI CCDG 1 cut(s) 102
Lsp1109I GCAGC 1 cut(s) 155
MaeI CTAG 1 cut(s) 283
MaeIII GTNAC 1 cut(s) 205
MalI GATC 1 cut(s) 264
MboI GATC 1 cut(s) 262
MboII GAAGA 2 cut(s) 151, 154
MluCI AATT 1 cut(s) 15
MnlI CCTC 3 cut(s) 37, 107, 209
MspA1I CMGCKG 1 cut(s) 168
NdeII GATC 1 cut(s) 262
PkrI GCNGC 2 cut(s) 170, 214
PsrI GAACNNNNNNTAC 2 cut(s) 214, 246
RsaI GTAC 1 cut(s) 223
RsaNI GTAC 1 cut(s) 222
SatI GCNGC 2 cut(s) 169, 213
Sau3AI GATC 1 cut(s) 262
SetI ASST 3 cut(s) 55, 91, 277
SgeI CNNG 5 cut(s) 101, 207, 215, 246, 278
Sse9I AATT 1 cut(s) 15
SsiI CCGC 2 cut(s) 166, 213
SspI AATATT 1 cut(s) 58
SspMI CTAG 1 cut(s) 283
TasI AATT 1 cut(s) 15
TauI GCSGC 1 cut(s) 215
TscAI CASTG 1 cut(s) 139
TseI GCWGC 1 cut(s) 168
TspRI CASTG 1 cut(s) 139
XapI RAATTY 1 cut(s) 15
XspI CTAG 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.