RchiOBHm_Chr6g0271291

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Forward (+)
30774917 .. 30775727
811 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ24336

Sequence Viewer

Length: 180 bp
ATGGCAATATACCCAGATGAATTTCCCTCTAATCCTATTCACTCCATCAAACCTAATATTCATCGCTGTTGGCAGAAAAGAAAAAAACATGTGTTTTCTCTCTTTGATGATATGAACGCACATTATCCATCCATCACTGATGTTTTCGTCTTTTTCATAGTCTTCTTTCGCTGTTCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

7.12

Weight (kDa)

8.74

Isoelectric Point (pI)

49.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 20
AflIII ACRYGT 1 cut(s) 88
ApoI RAATTY 1 cut(s) 20
BbsI GAAGAC 1 cut(s) 154
BccI CCATC 3 cut(s) 53, 136, 140
BpiI GAAGAC 1 cut(s) 154
BseGI GGATG 1 cut(s) 128
BstF5I GGATG 1 cut(s) 128
BstNSI RCATGY 1 cut(s) 92
BstV2I GAAGAC 1 cut(s) 154
BtgZI GCGATG 1 cut(s) 47
BtsCI GGATG 1 cut(s) 128
BtsIMutI CAGTG 1 cut(s) 135
CviAII CATG 1 cut(s) 89
FaeI CATG 1 cut(s) 92
FaiI YATR 4 cut(s) 10, 90, 113, 158
FatI CATG 1 cut(s) 88
FokI GGATG 1 cut(s) 115
Hin1II CATG 1 cut(s) 92
Hsp92II CATG 1 cut(s) 92
LpnPI CCDG 1 cut(s) 27
MboII GAAGA 1 cut(s) 154
MluCI AATT 1 cut(s) 20
MnlI CCTC 1 cut(s) 37
MseI TTAA 1 cut(s) 178
NlaIII CATG 1 cut(s) 92
NspI RCATGY 1 cut(s) 92
PciI ACATGT 1 cut(s) 88
PscI ACATGT 1 cut(s) 88
SaqAI TTAA 1 cut(s) 178
SetI ASST 1 cut(s) 55
SgeI CNNG 2 cut(s) 26, 101
Sse9I AATT 1 cut(s) 20
SspI AATATT 1 cut(s) 58
TasI AATT 1 cut(s) 20
Tru1I TTAA 1 cut(s) 178
Tru9I TTAA 1 cut(s) 178
TscAI CASTG 1 cut(s) 142
TspDTI ATGAA 4 cut(s) 33, 50, 128, 145
TspRI CASTG 1 cut(s) 142
XapI RAATTY 1 cut(s) 20
XceI RCATGY 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.