RchiOBHm_Chr2g0151581

Peptidase of plants and bacteria

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
69177222 .. 69177506
285 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 285 bp
ATGGTGGAGTACCTAAGAATGGTGGCGGAAGGGTTTGGTGGCCTGAAAAGTGGTGCTTCCAGCTGGAAATTGCCAGAGGGCGAGGGCTACATTTGGTGGGAGGACAAGGACCCTGTAGCCGTGGCAAAGTTGTTGCACTATTATGAGGGGTACAGGAAGGGCTTCATTAAACGGCTGAATAGAGCTATAAAGGATGAGTGGCATGATTGGACGGTGGATGATGCGTTAGGCATGCCATTACAAAATTTGTGCGATAAATATAATTTTTCCAGGTCCAGCTATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

11.0

Weight (kDa)

6.08

Isoelectric Point (pI)

34.5

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
BSP PF04450 1 - 87 2.2e-10 Peptidase of plants and bacteria
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015977)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 26
AcsI RAATTY 1 cut(s) 244
AfaI GTAC 2 cut(s) 11, 152
AfiI CCNNNNNNNGG 1 cut(s) 19
AjnI CCWGG 1 cut(s) 269
AluBI AGCT 3 cut(s) 63, 185, 279
AluI AGCT 3 cut(s) 63, 185, 279
AoxI GGCC 1 cut(s) 40
ApoI RAATTY 1 cut(s) 244
Asp700I GAANNNNTTC 1 cut(s) 161
AspS9I GGNCC 2 cut(s) 109, 273
AvaII GGWCC 2 cut(s) 109, 273
BceAI ACGGC 2 cut(s) 104, 188
BciT130I CCWGG 1 cut(s) 271
BfmI CTRYAG 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 271
Bme18I GGWCC 2 cut(s) 109, 273
BmgT120I GGNCC 2 cut(s) 109, 273
BmiI GGNNCC 1 cut(s) 111
BmrFI CCNGG 1 cut(s) 271
BmsI GCATC 1 cut(s) 211
BsaJI CCNNGG 1 cut(s) 120
Bsc4I CCNNNNNNNGG 1 cut(s) 19
BseBI CCWGG 1 cut(s) 271
BseDI CCNNGG 1 cut(s) 120
BseGI GGATG 2 cut(s) 199, 223
BseLI CCNNNNNNNGG 1 cut(s) 19
BshFI GGCC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 19
BsnI GGCC 1 cut(s) 42
BspACI CCGC 1 cut(s) 26
BspANI GGCC 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 111
BssECI CCNNGG 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 271
Bst4CI ACNGT 1 cut(s) 214
BstC8I GCNNGC 1 cut(s) 233
BstDEI CTNAG 1 cut(s) 14
BstDSI CCRYGG 1 cut(s) 120
BstF5I GGATG 2 cut(s) 199, 223
BstNI CCWGG 1 cut(s) 271
BstNSI RCATGY 1 cut(s) 235
BstSCI CCNGG 1 cut(s) 269
BstSFI CTRYAG 1 cut(s) 114
BsuRI GGCC 1 cut(s) 42
BtgI CCRYGG 1 cut(s) 120
BtsCI GGATG 2 cut(s) 199, 223
Cac8I GCNNGC 1 cut(s) 233
Cfr13I GGNCC 2 cut(s) 109, 273
Csp6I GTAC 2 cut(s) 10, 151
CviAII CATG 2 cut(s) 203, 232
CviJI RGCY 8 cut(s) 42, 63, 87, 119, 162, 175, 185, 279
CviKI_1 RGCY 8 cut(s) 42, 63, 87, 119, 162, 175, 185, 279
CviQI GTAC 2 cut(s) 10, 151
DdeI CTNAG 1 cut(s) 14
EciI GGCGGA 1 cut(s) 41
Eco47I GGWCC 2 cut(s) 109, 273
EcoO109I RGGNCCY 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 269
FaeI CATG 2 cut(s) 206, 235
FaiI YATR 5 cut(s) 144, 188, 204, 233, 261
FalI AAGNNNNNCTT 2 cut(s) 40, 72
FatI CATG 2 cut(s) 202, 231
FokI GGATG 2 cut(s) 206, 230
HaeIII GGCC 1 cut(s) 42
Hin1II CATG 2 cut(s) 206, 235
HpyAV CCTTC 2 cut(s) 23, 151
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 136
HpyF3I CTNAG 1 cut(s) 14
Hsp92II CATG 2 cut(s) 206, 235
LpnPI CCDG 7 cut(s) 49, 56, 73, 87, 126, 139, 256
LweI GCATC 1 cut(s) 211
MluCI AATT 3 cut(s) 68, 244, 262
MnlI CCTC 4 cut(s) 70, 76, 94, 139
MroXI GAANNNNTTC 1 cut(s) 161
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 1 cut(s) 141
MspA1I CMGCKG 1 cut(s) 63
MspR9I CCNGG 1 cut(s) 271
MvaI CCWGG 1 cut(s) 271
NlaIII CATG 2 cut(s) 206, 235
NlaIV GGNNCC 1 cut(s) 111
NspI RCATGY 1 cut(s) 235
PaeI GCATGC 1 cut(s) 235
PdmI GAANNNNTTC 1 cut(s) 161
PpuMI RGGWCCY 1 cut(s) 109
Psp5II RGGWCCY 1 cut(s) 109
Psp6I CCWGG 1 cut(s) 269
PspGI CCWGG 1 cut(s) 269
PspN4I GGNNCC 1 cut(s) 111
PspPI GGNCC 2 cut(s) 109, 273
PspPPI RGGWCCY 1 cut(s) 109
PvuII CAGCTG 1 cut(s) 63
RsaI GTAC 2 cut(s) 11, 152
RsaNI GTAC 2 cut(s) 10, 151
RseI CAYNNNNRTG 1 cut(s) 141
SaqAI TTAA 1 cut(s) 168
Sau96I GGNCC 2 cut(s) 109, 273
ScrFI CCNGG 1 cut(s) 271
SetI ASST 5 cut(s) 15, 65, 187, 275, 281
SfaNI GCATC 1 cut(s) 211
SfcI CTRYAG 1 cut(s) 114
SinI GGWCC 2 cut(s) 109, 273
SmiMI CAYNNNNRTG 1 cut(s) 141
SphI GCATGC 1 cut(s) 235
Sse9I AATT 3 cut(s) 68, 244, 262
SsiI CCGC 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 269
TaaI ACNGT 1 cut(s) 214
TasI AATT 3 cut(s) 68, 244, 262
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TspDTI ATGAA 1 cut(s) 154
VpaK11BI GGWCC 2 cut(s) 109, 273
XapI RAATTY 1 cut(s) 244
XceI RCATGY 1 cut(s) 235
XmnI GAANNNNTTC 1 cut(s) 161
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.