RchiOBHm_Chr1g0339421

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
30768582 .. 30768963
382 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 201 bp
ATGGCCTCATTCATGCCATTTGGATTGGGACCTAGAATGTGTGTGGGTATCAACTTTGCTGTCACTGAAGCAAAGATTGCTCTGTCAATGATTCTACAACGCTACTCATTTACCCTTTCCCCAGGTTATGTCCACTCGCCTTCTCAGTTTGTTACTATTCGTCCACAACATGGAGTTCAAGTAATTCTACAGTCACTTTGA

Protein Analysis

66

Amino Acids

7.27

Weight (kDa)

9.78

Isoelectric Point (pI)

54.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 3 - 45 1.2e-12 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019229)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 170
AcuI CTGAAG 1 cut(s) 87
AfiI CCNNNNNNNGG 1 cut(s) 170
AgsI TTSAA 1 cut(s) 179
AjnI CCWGG 1 cut(s) 121
AoxI GGCC 1 cut(s) 3
AspS9I GGNCC 1 cut(s) 29
AvaII GGWCC 1 cut(s) 29
BciT130I CCWGG 1 cut(s) 123
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 188
Bme1390I CCNGG 1 cut(s) 123
Bme18I GGWCC 1 cut(s) 29
BmgT120I GGNCC 1 cut(s) 29
BmiI GGNNCC 1 cut(s) 30
BmrFI CCNGG 1 cut(s) 123
BsaJI CCNNGG 1 cut(s) 121
BsaXI ACNNNNNCTCC 2 cut(s) 165, 195
Bsc4I CCNNNNNNNGG 1 cut(s) 170
BseBI CCWGG 1 cut(s) 123
BseDI CCNNGG 1 cut(s) 121
BseLI CCNNNNNNNGG 1 cut(s) 170
BseMII CTCAG 1 cut(s) 158
BshFI GGCC 1 cut(s) 5
BslFI GGGAC 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 170
BsmFI GGGAC 1 cut(s) 42
BsnI GGCC 1 cut(s) 5
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 157
BspLI GGNNCC 1 cut(s) 30
BssECI CCNNGG 1 cut(s) 121
Bst2UI CCWGG 1 cut(s) 123
Bst4CI ACNGT 1 cut(s) 192
BstAPI GCANNNNNTGC 1 cut(s) 77
BstDEI CTNAG 1 cut(s) 144
BstMWI GCNNNNNNNGC 1 cut(s) 77
BstNI CCWGG 1 cut(s) 123
BstSCI CCNGG 1 cut(s) 121
BstSFI CTRYAG 1 cut(s) 188
BsuRI GGCC 1 cut(s) 5
BtsIMutI CAGTG 1 cut(s) 63
Cfr13I GGNCC 1 cut(s) 29
CviAII CATG 2 cut(s) 13, 170
CviJI RGCY 1 cut(s) 5
CviKI_1 RGCY 1 cut(s) 5
DdeI CTNAG 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 29
Eco57I CTGAAG 1 cut(s) 87
EcoO109I RGGNCCY 1 cut(s) 29
EcoRII CCWGG 1 cut(s) 121
FaeI CATG 2 cut(s) 16, 173
FaiI YATR 3 cut(s) 14, 129, 171
FaqI GGGAC 1 cut(s) 42
FatI CATG 2 cut(s) 12, 169
FspBI CTAG 1 cut(s) 33
HaeIII GGCC 1 cut(s) 5
Hin1II CATG 2 cut(s) 16, 173
HinfI GANTC 1 cut(s) 91
Hpy166II GTNNAC 2 cut(s) 133, 164
Hpy8I GTNNAC 2 cut(s) 133, 164
HpyAV CCTTC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 192
HpyF10VI GCNNNNNNNGC 1 cut(s) 77
HpyF3I CTNAG 1 cut(s) 144
Hsp92II CATG 2 cut(s) 16, 173
LpnPI CCDG 2 cut(s) 108, 135
MaeI CTAG 1 cut(s) 33
MaeIII GTNAC 3 cut(s) 61, 151, 192
MluCI AATT 1 cut(s) 183
MnlI CCTC 1 cut(s) 16
MspR9I CCNGG 1 cut(s) 123
MvaI CCWGG 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 77
NlaIII CATG 2 cut(s) 16, 173
NlaIV GGNNCC 1 cut(s) 30
NmuCI GTSAC 2 cut(s) 61, 192
PfeI GAWTC 1 cut(s) 91
PflMI CCANNNNNTGG 1 cut(s) 170
PpuMI RGGWCCY 1 cut(s) 29
Psp5II RGGWCCY 1 cut(s) 29
Psp6I CCWGG 1 cut(s) 121
PspGI CCWGG 1 cut(s) 121
PspN4I GGNNCC 1 cut(s) 30
PspPI GGNCC 1 cut(s) 29
PspPPI RGGWCCY 1 cut(s) 29
Sau96I GGNCC 1 cut(s) 29
ScrFI CCNGG 1 cut(s) 123
SetI ASST 2 cut(s) 34, 127
SfcI CTRYAG 1 cut(s) 188
SgeI CNNG 7 cut(s) 25, 45, 134, 135, 148, 182, 191
SinI GGWCC 1 cut(s) 29
Sse9I AATT 1 cut(s) 183
SspMI CTAG 1 cut(s) 33
StyD4I CCNGG 1 cut(s) 121
TaaI ACNGT 1 cut(s) 192
TasI AATT 1 cut(s) 183
TfiI GAWTC 1 cut(s) 91
TscAI CASTG 1 cut(s) 70
TseFI GTSAC 2 cut(s) 61, 192
Tsp45I GTSAC 2 cut(s) 61, 192
TspRI CASTG 1 cut(s) 70
Van91I CCANNNNNTGG 1 cut(s) 170
VpaK11BI GGWCC 1 cut(s) 29
XspI CTAG 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.