RchiOBHm_Chr4g0437461

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
60541040 .. 60541270
231 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ40571

Sequence Viewer

Length: 177 bp
ATGGGGCCTAGAATTTGTGCAGGCTTCAACTTTGCAACCGTTGAAGCAAAGATTGCTCTGTCAATGACTCTACAGCGCTACAGCCTCACCCTTTCCCCAGGTTATGCTCACTCTCCCCATCAATATCACACTATTCGCCCACAACATGGGGTTCAGGTGATGCTCCACCCACTGTGA

Protein Analysis

58

Amino Acids

6.47

Weight (kDa)

9.62

Isoelectric Point (pI)

27.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 1 - 40 1.8e-07 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019229)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AcsI RAATTY 1 cut(s) 12
AfeI AGCGCT 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 146
AgsI TTSAA 2 cut(s) 28, 44
AjnI CCWGG 1 cut(s) 97
Aor51HI AGCGCT 1 cut(s) 77
AoxI GGCC 1 cut(s) 5
ApoI RAATTY 1 cut(s) 12
AspLEI GCGC 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 5
AsuHPI GGTGA 2 cut(s) 79, 169
BccI CCATC 1 cut(s) 126
BciT130I CCWGG 1 cut(s) 99
BfaI CTAG 1 cut(s) 9
BfmI CTRYAG 2 cut(s) 71, 79
BfoI RGCGCY 1 cut(s) 79
Bme1390I CCNGG 1 cut(s) 99
BmgT120I GGNCC 1 cut(s) 5
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 99
BmsI GCATC 1 cut(s) 150
BsaJI CCNNGG 1 cut(s) 97
Bsc4I CCNNNNNNNGG 1 cut(s) 146
BseBI CCWGG 1 cut(s) 99
BseDI CCNNGG 1 cut(s) 97
BseLI CCNNNNNNNGG 1 cut(s) 146
BsgI GTGCAG 1 cut(s) 39
BshFI GGCC 1 cut(s) 7
BslI CCNNNNNNNGG 1 cut(s) 146
BsnI GGCC 1 cut(s) 7
BspANI GGCC 1 cut(s) 7
BspLI GGNNCC 1 cut(s) 6
BssECI CCNNGG 1 cut(s) 97
Bst2UI CCWGG 1 cut(s) 99
Bst4CI ACNGT 2 cut(s) 40, 174
BstAPI GCANNNNNTGC 1 cut(s) 53
BstC8I GCNNGC 1 cut(s) 22
BstH2I RGCGCY 1 cut(s) 79
BstHHI GCGC 1 cut(s) 78
BstMWI GCNNNNNNNGC 1 cut(s) 53
BstNI CCWGG 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 97
BstSFI CTRYAG 2 cut(s) 71, 79
BsuRI GGCC 1 cut(s) 7
BtsIMutI CAGTG 1 cut(s) 170
Cac8I GCNNGC 1 cut(s) 22
CfoI GCGC 1 cut(s) 78
Cfr13I GGNCC 1 cut(s) 5
CviAII CATG 1 cut(s) 146
CviJI RGCY 3 cut(s) 7, 24, 84
CviKI_1 RGCY 3 cut(s) 7, 24, 84
Eco47III AGCGCT 1 cut(s) 77
EcoO109I RGGNCCY 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 97
FaeI CATG 1 cut(s) 149
FaiI YATR 2 cut(s) 105, 147
FatI CATG 1 cut(s) 145
FspBI CTAG 1 cut(s) 9
GlaI GCGC 1 cut(s) 77
HaeII RGCGCY 1 cut(s) 79
HaeIII GGCC 1 cut(s) 7
HhaI GCGC 1 cut(s) 78
Hin1II CATG 1 cut(s) 149
Hin6I GCGC 1 cut(s) 76
HinP1I GCGC 1 cut(s) 76
HinfI GANTC 1 cut(s) 67
HphI GGTGA 2 cut(s) 79, 169
HpyCH4III ACNGT 2 cut(s) 40, 174
HpyCH4V TGCA 2 cut(s) 20, 35
HpyF10VI GCNNNNNNNGC 1 cut(s) 53
Hsp92II CATG 1 cut(s) 149
HspAI GCGC 1 cut(s) 76
LmnI GCTCC 1 cut(s) 168
LpnPI CCDG 4 cut(s) 6, 84, 111, 140
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 9
MluCI AATT 1 cut(s) 12
MlyI GAGTC 1 cut(s) 61
MnlI CCTC 1 cut(s) 95
MspR9I CCNGG 1 cut(s) 99
MvaI CCWGG 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 53
NlaIII CATG 1 cut(s) 149
NlaIV GGNNCC 1 cut(s) 6
PflMI CCANNNNNTGG 1 cut(s) 146
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
Psp6I CCWGG 1 cut(s) 97
PspGI CCWGG 1 cut(s) 97
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 5
SchI GAGTC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 99
SetI ASST 2 cut(s) 103, 159
SfaNI GCATC 1 cut(s) 150
SfcI CTRYAG 2 cut(s) 71, 79
SgeI CNNG 6 cut(s) 21, 33, 110, 111, 158, 167
Sse9I AATT 1 cut(s) 12
SspMI CTAG 1 cut(s) 9
StyD4I CCNGG 1 cut(s) 97
TaaI ACNGT 2 cut(s) 40, 174
TasI AATT 1 cut(s) 12
TscAI CASTG 1 cut(s) 177
TspRI CASTG 1 cut(s) 177
Van91I CCANNNNNTGG 1 cut(s) 146
XapI RAATTY 1 cut(s) 12
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.