Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0019229

Physical Location & Seq

Genomic Coordinates Forward (+)

30768582 .. 30768963

Gene Structure 382 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ56633

Sequence Viewer

CDS Protein Promoter (2k)

Length: 201 bp

ATGGCCTCATTCATGCCATTTGGATTGGGACCTAGAATGTGTGTGGGTATCAACTTTGCTGTCACTGAAGCAAAGATTGCTCTGTCAATGATTCTACAACGCTACTCATTTACCCTTTCCCCAGGTTATGTCCACTCGCCTTCTCAGTTTGTTACTATTCGTCCACAACATGGAGTTCAAGTAATTCTACAGTCACTTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0004497 GO:0006629 GO:0008150 GO:0008152 GO:0008202 GO:0008395 GO:0009719 GO:0009725 GO:0009741 GO:0010033 GO:0010268 GO:0010817 GO:0014070 GO:0016128 GO:0016131 GO:0016491 GO:0033993 GO:0042221 GO:0042445 GO:0042592 GO:0044238 GO:0048878 GO:0050896 GO:0055088 GO:0055114 GO:0065007 GO:0065008 GO:0071704 GO:1901360 GO:1901615 GO:1901700

KEGG Pathways

Metabolic & Signaling

ko00905 map00905

Pfam Domains

Protein Families

p450

Protein Analysis

66

Amino Acids

7.27

Weight (kDa)

9.78

Isoelectric Point (pI)

54.29

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
p450	PF00067	3 - 45	1.2e-12	Cytochrome P450

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019229)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_4g29180
malus_domestica	MD13G1057300.v1.1
rosa_chinensis	RchiOBHm_Chr1g0339421 RchiOBHm_Chr2g0110971 RchiOBHm_Chr4g0437461
rosa_multiflora	Rmu_sc0002472.1_g000007 Rmu_sc0002638.1_g000038 Rmu_sc0036394.1_g000001

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	170
AcuI	CTGAAG	1 cut(s)	87
AfiI	CCNNNNNNNGG	1 cut(s)	170
AgsI	TTSAA	1 cut(s)	179
AjnI	CCWGG	1 cut(s)	121
AoxI	GGCC	1 cut(s)	3
AspS9I	GGNCC	1 cut(s)	29
AvaII	GGWCC	1 cut(s)	29
BciT130I	CCWGG	1 cut(s)	123
BfaI	CTAG	1 cut(s)	33
BfmI	CTRYAG	1 cut(s)	188
Bme1390I	CCNGG	1 cut(s)	123
Bme18I	GGWCC	1 cut(s)	29
BmgT120I	GGNCC	1 cut(s)	29
BmiI	GGNNCC	1 cut(s)	30
BmrFI	CCNGG	1 cut(s)	123
BsaJI	CCNNGG	1 cut(s)	121
BsaXI	ACNNNNNCTCC	2 cut(s)	165, 195
Bsc4I	CCNNNNNNNGG	1 cut(s)	170
BseBI	CCWGG	1 cut(s)	123
BseDI	CCNNGG	1 cut(s)	121
BseLI	CCNNNNNNNGG	1 cut(s)	170
BseMII	CTCAG	1 cut(s)	158
BshFI	GGCC	1 cut(s)	5
BslFI	GGGAC	1 cut(s)	42
BslI	CCNNNNNNNGG	1 cut(s)	170
BsmFI	GGGAC	1 cut(s)	42
BsnI	GGCC	1 cut(s)	5
BspANI	GGCC	1 cut(s)	5
BspCNI	CTCAG	1 cut(s)	157
BspLI	GGNNCC	1 cut(s)	30
BssECI	CCNNGG	1 cut(s)	121
Bst2UI	CCWGG	1 cut(s)	123
Bst4CI	ACNGT	1 cut(s)	192
BstAPI	GCANNNNNTGC	1 cut(s)	77
BstDEI	CTNAG	1 cut(s)	144
BstMWI	GCNNNNNNNGC	1 cut(s)	77
BstNI	CCWGG	1 cut(s)	123
BstSCI	CCNGG	1 cut(s)	121
BstSFI	CTRYAG	1 cut(s)	188
BsuRI	GGCC	1 cut(s)	5
BtsIMutI	CAGTG	1 cut(s)	63
Cfr13I	GGNCC	1 cut(s)	29
CviAII	CATG	2 cut(s)	13, 170
CviJI	RGCY	1 cut(s)	5
CviKI_1	RGCY	1 cut(s)	5
DdeI	CTNAG	1 cut(s)	144
Eco47I	GGWCC	1 cut(s)	29
Eco57I	CTGAAG	1 cut(s)	87
EcoO109I	RGGNCCY	1 cut(s)	29
EcoRII	CCWGG	1 cut(s)	121
FaeI	CATG	2 cut(s)	16, 173
FaiI	YATR	3 cut(s)	14, 129, 171
FaqI	GGGAC	1 cut(s)	42
FatI	CATG	2 cut(s)	12, 169
FspBI	CTAG	1 cut(s)	33
HaeIII	GGCC	1 cut(s)	5
Hin1II	CATG	2 cut(s)	16, 173
HinfI	GANTC	1 cut(s)	91
Hpy166II	GTNNAC	2 cut(s)	133, 164
Hpy8I	GTNNAC	2 cut(s)	133, 164
HpyAV	CCTTC	1 cut(s)	150
HpyCH4III	ACNGT	1 cut(s)	192
HpyF10VI	GCNNNNNNNGC	1 cut(s)	77
HpyF3I	CTNAG	1 cut(s)	144
Hsp92II	CATG	2 cut(s)	16, 173
LpnPI	CCDG	2 cut(s)	108, 135
MaeI	CTAG	1 cut(s)	33
MaeIII	GTNAC	3 cut(s)	61, 151, 192
MluCI	AATT	1 cut(s)	183
MnlI	CCTC	1 cut(s)	16
MspR9I	CCNGG	1 cut(s)	123
MvaI	CCWGG	1 cut(s)	123
MwoI	GCNNNNNNNGC	1 cut(s)	77
NlaIII	CATG	2 cut(s)	16, 173
NlaIV	GGNNCC	1 cut(s)	30
NmuCI	GTSAC	2 cut(s)	61, 192
PfeI	GAWTC	1 cut(s)	91
PflMI	CCANNNNNTGG	1 cut(s)	170
PpuMI	RGGWCCY	1 cut(s)	29
Psp5II	RGGWCCY	1 cut(s)	29
Psp6I	CCWGG	1 cut(s)	121
PspGI	CCWGG	1 cut(s)	121
PspN4I	GGNNCC	1 cut(s)	30
PspPI	GGNCC	1 cut(s)	29
PspPPI	RGGWCCY	1 cut(s)	29
Sau96I	GGNCC	1 cut(s)	29
ScrFI	CCNGG	1 cut(s)	123
SetI	ASST	2 cut(s)	34, 127
SfcI	CTRYAG	1 cut(s)	188
SgeI	CNNG	7 cut(s)	25, 45, 134, 135, 148, 182, 191
SinI	GGWCC	1 cut(s)	29
Sse9I	AATT	1 cut(s)	183
SspMI	CTAG	1 cut(s)	33
StyD4I	CCNGG	1 cut(s)	121
TaaI	ACNGT	1 cut(s)	192
TasI	AATT	1 cut(s)	183
TfiI	GAWTC	1 cut(s)	91
TscAI	CASTG	1 cut(s)	70
TseFI	GTSAC	2 cut(s)	61, 192
Tsp45I	GTSAC	2 cut(s)	61, 192
TspRI	CASTG	1 cut(s)	70
Van91I	CCANNNNNTGG	1 cut(s)	170
VpaK11BI	GGWCC	1 cut(s)	29
XspI	CTAG	1 cut(s)	33

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.