Rmu_sc0036394.1_g000001

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0036394.1
Physical Location & Seq
Forward (+)
1 .. 245
245 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0036394.1_g000001.1.cds

Sequence Viewer

Length: 155 bp
gcttcaactatgcaaccattgaagcaaagattgctctgtcaatgactctacagcgctacagcttcaccctttacccaggttgtgctcactctccccatcaatatcacactattcgcccacaacatggggttcaggtgatgctccacccactgtga

Protein Analysis

50

Amino Acids

5.77

Weight (kDa)

9.05

Isoelectric Point (pI)

38.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019229)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 124
AfeI AGCGCT 1 cut(s) 55
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 2 cut(s) 6, 22
AjnI CCWGG 1 cut(s) 75
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
Alw21I GWGCWC 1 cut(s) 87
Aor51HI AGCGCT 1 cut(s) 55
AspLEI GCGC 1 cut(s) 56
AsuHPI GGTGA 2 cut(s) 57, 147
Bbv12I GWGCWC 1 cut(s) 87
BccI CCATC 1 cut(s) 104
BciT130I CCWGG 1 cut(s) 77
BfmI CTRYAG 2 cut(s) 49, 57
BfoI RGCGCY 1 cut(s) 57
Bme1390I CCNGG 1 cut(s) 77
BmrFI CCNGG 1 cut(s) 77
BmsI GCATC 1 cut(s) 128
BsaJI CCNNGG 1 cut(s) 75
Bsc4I CCNNNNNNNGG 1 cut(s) 124
BseBI CCWGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 75
BseLI CCNNNNNNNGG 1 cut(s) 124
BsiHKAI GWGCWC 1 cut(s) 87
BslI CCNNNNNNNGG 1 cut(s) 124
Bsp1286I GDGCHC 1 cut(s) 87
BssECI CCNNGG 1 cut(s) 75
Bst2UI CCWGG 1 cut(s) 77
Bst4CI ACNGT 1 cut(s) 152
BstAPI GCANNNNNTGC 1 cut(s) 31
BstH2I RGCGCY 1 cut(s) 57
BstHHI GCGC 1 cut(s) 56
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNI CCWGG 1 cut(s) 77
BstSCI CCNGG 1 cut(s) 75
BstSFI CTRYAG 2 cut(s) 49, 57
BtsIMutI CAGTG 1 cut(s) 148
CfoI GCGC 1 cut(s) 56
CviAII CATG 1 cut(s) 124
CviJI RGCY 1 cut(s) 62
CviKI_1 RGCY 1 cut(s) 62
Eco47III AGCGCT 1 cut(s) 55
EcoRII CCWGG 1 cut(s) 75
FaeI CATG 1 cut(s) 127
FaiI YATR 2 cut(s) 11, 125
FatI CATG 1 cut(s) 123
GlaI GCGC 1 cut(s) 55
HaeII RGCGCY 1 cut(s) 57
HhaI GCGC 1 cut(s) 56
Hin1II CATG 1 cut(s) 127
Hin6I GCGC 1 cut(s) 54
HinP1I GCGC 1 cut(s) 54
HinfI GANTC 1 cut(s) 45
HphI GGTGA 2 cut(s) 57, 147
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 13
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
Hsp92II CATG 1 cut(s) 127
HspAI GCGC 1 cut(s) 54
LmnI GCTCC 1 cut(s) 146
LpnPI CCDG 3 cut(s) 62, 89, 118
LweI GCATC 1 cut(s) 128
MhlI GDGCHC 1 cut(s) 87
MlyI GAGTC 1 cut(s) 39
MspR9I CCNGG 1 cut(s) 77
MvaI CCWGG 1 cut(s) 77
MwoI GCNNNNNNNGC 1 cut(s) 31
NlaIII CATG 1 cut(s) 127
PflMI CCANNNNNTGG 1 cut(s) 124
PleI GAGTC 1 cut(s) 39
PpsI GAGTC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 75
PspGI CCWGG 1 cut(s) 75
SchI GAGTC 1 cut(s) 39
ScrFI CCNGG 1 cut(s) 77
SduI GDGCHC 1 cut(s) 87
SetI ASST 3 cut(s) 64, 81, 137
SfaNI GCATC 1 cut(s) 128
SfcI CTRYAG 2 cut(s) 49, 57
SgeI CNNG 4 cut(s) 88, 89, 136, 145
StyD4I CCNGG 1 cut(s) 75
TaaI ACNGT 1 cut(s) 152
TscAI CASTG 1 cut(s) 155
TspRI CASTG 1 cut(s) 155
Van91I CCANNNNNTGG 1 cut(s) 124
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.