RchiOBHm_Chr1g0354811

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
47625288 .. 47627196
1909 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58033

Sequence Viewer

Length: 237 bp
ATGAACCCACAAGTGGATAAGCTGGTGAGGGGGACAACAATAGTGGCTACTATCACTGCTTCCTATTTTCTCTTAACCGCTGATTATGGCCCTGAGCCCAATGTTCTCGACCCTATCAAGAAGGCAATACAGTCTGCAGAAATCTCCGTTAAAGACTTCATCTTTGGATCAAAGACTCAACCTCCAGAAAGCGAACTGAAGAAGCTGATTTCTAACAGCGCAAAGGAACATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.53

Weight (kDa)

6.55

Isoelectric Point (pI)

19.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 175
AcuI CTGAAG 1 cut(s) 218
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 2 cut(s) 22, 205
AluI AGCT 2 cut(s) 22, 205
AlwI GGATC 1 cut(s) 175
AoxI GGCC 1 cut(s) 88
ArsI GACNNNNNNTTYG 2 cut(s) 146, 178
AspLEI GCGC 1 cut(s) 221
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 37
BanII GRGCYC 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 135
BmgT120I GGNCC 1 cut(s) 89
BpmI CTGGAG 1 cut(s) 168
Bpu10I CCTNAGC 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 166, 196
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 84
BshFI GGCC 1 cut(s) 90
BslFI GGGAC 1 cut(s) 46
BslI CCNNNNNNNGG 1 cut(s) 13
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 1 cut(s) 90
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 1 cut(s) 78
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 85
BspMAI CTGCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 175
BssMI GATC 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 132
BstDEI CTNAG 2 cut(s) 93, 234
BstF5I GGATG 1 cut(s) 229
BstHHI GCGC 1 cut(s) 221
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstSFI CTRYAG 1 cut(s) 135
BsuRI GGCC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 229
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
CfoI GCGC 1 cut(s) 221
Cfr13I GGNCC 1 cut(s) 89
CspCI CAANNNNNGTGG 2 cut(s) 24, 59
CviJI RGCY 5 cut(s) 22, 47, 90, 97, 205
CviKI_1 RGCY 5 cut(s) 22, 47, 90, 97, 205
DdeI CTNAG 2 cut(s) 93, 234
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Eco24I GRGCYC 1 cut(s) 99
Eco57I CTGAAG 1 cut(s) 218
EcoT38I GRGCYC 1 cut(s) 99
FaiI YATR 1 cut(s) 87
FaqI GGGAC 1 cut(s) 46
FokI GGATG 1 cut(s) 216
FriOI GRGCYC 1 cut(s) 99
GlaI GCGC 1 cut(s) 220
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 90
HhaI GCGC 1 cut(s) 221
Hin6I GCGC 1 cut(s) 219
HinP1I GCGC 1 cut(s) 219
HinfI GANTC 1 cut(s) 175
HphI GGTGA 1 cut(s) 37
Hpy188III TCNNGA 3 cut(s) 107, 118, 185
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 1 cut(s) 132
HpyCH4V TGCA 1 cut(s) 137
HpyF3I CTNAG 2 cut(s) 93, 234
HspAI GCGC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 167
LpnPI CCDG 3 cut(s) 8, 105, 198
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MboII GAAGA 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 99
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 2 cut(s) 21, 192
MseI TTAA 2 cut(s) 74, 150
MspA1I CMGCKG 1 cut(s) 80
NdeII GATC 1 cut(s) 167
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspPI GGNCC 1 cut(s) 89
PstI CTGCAG 1 cut(s) 139
SaqAI TTAA 2 cut(s) 74, 150
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 1 cut(s) 89
SchI GAGTC 1 cut(s) 169
SduI GDGCHC 1 cut(s) 99
SetI ASST 3 cut(s) 24, 184, 207
SfcI CTRYAG 1 cut(s) 135
SgeI CNNG 6 cut(s) 23, 35, 104, 119, 130, 197
SsiI CCGC 1 cut(s) 78
TaaI ACNGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 108
Tru1I TTAA 2 cut(s) 74, 150
Tru9I TTAA 2 cut(s) 74, 150
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 2 cut(s) 17, 148
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.