Rh1DG254000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
46812946 .. 46815046
2101 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG254000.1

Sequence Viewer

Length: 237 bp
ATGAACCCACAAGTGGATAAGCTGGTGAGGGGGACTACTATAGTGGCTACTATCACTGCTTCCTATTTTCTCTTAACCGCTGATTATGGCCCTGAGCCCAATGTTCTCGACCCTATTAAGAAGGCAATACAGTCCGCAGAAAGCTCCGTTAAAGACTTCATCTTTGGATCAAAGACTCAACCTCCAGAAAGCAAAGTGAAGGAGCTGGGTCCTAACAGCGGAAAGGAACATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.43

Weight (kDa)

6.55

Isoelectric Point (pI)

19.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 78, 135, 219
AclWI GGATC 1 cut(s) 175
AfiI CCNNNNNNNGG 2 cut(s) 13, 218
AluBI AGCT 3 cut(s) 22, 144, 205
AluI AGCT 3 cut(s) 22, 144, 205
AlwI GGATC 1 cut(s) 175
AoxI GGCC 1 cut(s) 88
ArsI GACNNNNNNTTYG 2 cut(s) 146, 178
AspS9I GGNCC 2 cut(s) 89, 209
AsuHPI GGTGA 1 cut(s) 37
AvaII GGWCC 1 cut(s) 209
BanII GRGCYC 1 cut(s) 99
BfmI CTRYAG 1 cut(s) 39
Bme18I GGWCC 1 cut(s) 209
BmgT120I GGNCC 2 cut(s) 89, 209
BmiI GGNNCC 1 cut(s) 210
BpmI CTGGAG 1 cut(s) 168
Bpu10I CCTNAGC 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 166, 196
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 218
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 2 cut(s) 13, 218
BseMII CTCAG 1 cut(s) 84
BseYI CCCAGC 1 cut(s) 205
BshFI GGCC 1 cut(s) 90
BslFI GGGAC 1 cut(s) 46
BslI CCNNNNNNNGG 2 cut(s) 13, 218
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 1 cut(s) 90
Bsp1286I GDGCHC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 3 cut(s) 78, 135, 219
BspANI GGCC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 1 cut(s) 210
BspPI GGATC 1 cut(s) 175
BssMI GATC 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 132
BstDEI CTNAG 2 cut(s) 93, 234
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstSFI CTRYAG 1 cut(s) 39
BsuRI GGCC 1 cut(s) 90
BtsCI GGATG 1 cut(s) 229
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
Cfr13I GGNCC 2 cut(s) 89, 209
CviJI RGCY 6 cut(s) 22, 47, 90, 97, 144, 205
CviKI_1 RGCY 6 cut(s) 22, 47, 90, 97, 144, 205
DdeI CTNAG 2 cut(s) 93, 234
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Eco24I GRGCYC 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 209
EcoO109I RGGNCCY 1 cut(s) 209
EcoT38I GRGCYC 1 cut(s) 99
FaiI YATR 2 cut(s) 41, 87
FaqI GGGAC 1 cut(s) 46
FokI GGATG 1 cut(s) 216
FriOI GRGCYC 1 cut(s) 99
GsaI CCCAGC 1 cut(s) 209
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 1 cut(s) 90
HinfI GANTC 1 cut(s) 175
HphI GGTGA 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 107, 185
HpyAV CCTTC 2 cut(s) 115, 193
HpyCH4III ACNGT 1 cut(s) 132
HpyF3I CTNAG 2 cut(s) 93, 234
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 2 cut(s) 149, 202
LpnPI CCDG 4 cut(s) 8, 105, 191, 198
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 99
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 2 cut(s) 21, 192
MseI TTAA 3 cut(s) 74, 117, 150
MspA1I CMGCKG 2 cut(s) 80, 219
NdeII GATC 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 210
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 209
Psp5II RGGWCCY 1 cut(s) 209
PspFI CCCAGC 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 210
PspPI GGNCC 2 cut(s) 89, 209
PspPPI RGGWCCY 1 cut(s) 209
SaqAI TTAA 3 cut(s) 74, 117, 150
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 2 cut(s) 89, 209
SchI GAGTC 1 cut(s) 169
SduI GDGCHC 1 cut(s) 99
SetI ASST 4 cut(s) 24, 146, 184, 207
SfcI CTRYAG 1 cut(s) 39
SgeI CNNG 6 cut(s) 23, 35, 104, 119, 197, 218
SinI GGWCC 1 cut(s) 209
SsiI CCGC 3 cut(s) 78, 135, 219
TaaI ACNGT 1 cut(s) 132
TaqI TCGA 1 cut(s) 108
Tru1I TTAA 3 cut(s) 74, 117, 150
Tru9I TTAA 3 cut(s) 74, 117, 150
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 2 cut(s) 17, 148
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.