Rw1G022590

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Forward (+)
47833542 .. 47834967
1426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G022590.1

Sequence Viewer

Length: 228 bp
ATGAACCCACAAGTGGATAAGGTGGTGAGGAGGACTACTATAGTGGCTACTATGAGTACTATCACTGCTTCCTATTTTCTCTTCACCGCTGATTATGGCTCTGAGCCCAATGTTCTCGACCCTTCCGCAGAAAGCTCCGTTAAAGACTTCATCTTTGGATCAATGACTCAACCTCCAGATAGCGAAGTGAAGAAGTTGGGCCCTAACAGTGCAAAGGAACATCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.18

Weight (kDa)

5.12

Isoelectric Point (pI)

33.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 87, 126
AclWI GGATC 1 cut(s) 166
AfaI GTAC 1 cut(s) 58
AfiI CCNNNNNNNGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 135
AluI AGCT 1 cut(s) 135
AlwI GGATC 1 cut(s) 166
AoxI GGCC 1 cut(s) 199
ApaI GGGCCC 1 cut(s) 203
ArsI GACNNNNNNTTYG 2 cut(s) 137, 169
AspS9I GGNCC 2 cut(s) 199, 200
AsuHPI GGTGA 2 cut(s) 37, 76
BaeGI GKGCMC 1 cut(s) 203
BanII GRGCYC 2 cut(s) 108, 203
BfmI CTRYAG 1 cut(s) 39
BmcAI AGTACT 1 cut(s) 58
BmgT120I GGNCC 2 cut(s) 199, 200
BmiI GGNNCC 1 cut(s) 201
BpmI CTGGAG 1 cut(s) 159
BsaXI ACNNNNNCTCC 2 cut(s) 157, 187
Bsc4I CCNNNNNNNGG 1 cut(s) 13
BseGI GGATG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 13
BseMII CTCAG 1 cut(s) 93
BseRI GAGGAG 1 cut(s) 43
BseSI GKGCMC 1 cut(s) 203
BshFI GGCC 1 cut(s) 201
BslI CCNNNNNNNGG 1 cut(s) 13
BsnI GGCC 1 cut(s) 201
Bsp120I GGGCCC 1 cut(s) 199
Bsp1286I GDGCHC 2 cut(s) 108, 203
Bsp143I GATC 1 cut(s) 158
BspACI CCGC 2 cut(s) 87, 126
BspANI GGCC 1 cut(s) 201
BspCNI CTCAG 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 201
BspPI GGATC 1 cut(s) 166
BssMI GATC 1 cut(s) 158
Bst4CI ACNGT 1 cut(s) 209
Bst6I CTCTTC 1 cut(s) 86
BstDEI CTNAG 2 cut(s) 102, 225
BstF5I GGATG 1 cut(s) 220
BstKTI GATC 1 cut(s) 161
BstMBI GATC 1 cut(s) 158
BstSFI CTRYAG 1 cut(s) 39
BstSLI GKGCMC 1 cut(s) 203
BsuRI GGCC 1 cut(s) 201
BtsCI GGATG 1 cut(s) 220
BtsI GCAGTG 1 cut(s) 63
BtsIMutI CAGTG 2 cut(s) 63, 214
Cfr13I GGNCC 2 cut(s) 199, 200
Csp6I GTAC 1 cut(s) 57
CviJI RGCY 5 cut(s) 47, 99, 106, 135, 201
CviKI_1 RGCY 5 cut(s) 47, 99, 106, 135, 201
CviQI GTAC 1 cut(s) 57
DdeI CTNAG 2 cut(s) 102, 225
DpnI GATC 1 cut(s) 160
DpnII GATC 1 cut(s) 158
Eam1104I CTCTTC 1 cut(s) 86
EarI CTCTTC 1 cut(s) 86
Eco24I GRGCYC 2 cut(s) 108, 203
EcoO109I RGGNCCY 1 cut(s) 200
EcoT38I GRGCYC 2 cut(s) 108, 203
FaiI YATR 3 cut(s) 41, 53, 96
FokI GGATG 1 cut(s) 207
FriOI GRGCYC 2 cut(s) 108, 203
GsuI CTGGAG 1 cut(s) 159
HaeIII GGCC 1 cut(s) 201
HinfI GANTC 1 cut(s) 166
HphI GGTGA 2 cut(s) 37, 76
Hpy188I TCNGA 1 cut(s) 103
Hpy188III TCNNGA 2 cut(s) 116, 176
HpyAV CCTTC 1 cut(s) 132
HpyCH4III ACNGT 1 cut(s) 209
HpyCH4V TGCA 1 cut(s) 212
HpyF3I CTNAG 2 cut(s) 102, 225
Kzo9I GATC 1 cut(s) 158
LmnI GCTCC 1 cut(s) 140
LpnPI CCDG 1 cut(s) 189
MalI GATC 1 cut(s) 160
MboI GATC 1 cut(s) 158
MboII GAAGA 2 cut(s) 73, 202
MhlI GDGCHC 2 cut(s) 108, 203
MlyI GAGTC 1 cut(s) 160
MnlI CCTC 3 cut(s) 21, 24, 183
MseI TTAA 1 cut(s) 141
MspA1I CMGCKG 1 cut(s) 89
NdeII GATC 1 cut(s) 158
NlaIV GGNNCC 1 cut(s) 201
PleI GAGTC 1 cut(s) 160
PpsI GAGTC 1 cut(s) 160
PspN4I GGNNCC 1 cut(s) 201
PspOMI GGGCCC 1 cut(s) 199
PspPI GGNCC 2 cut(s) 199, 200
RsaI GTAC 1 cut(s) 58
RsaNI GTAC 1 cut(s) 57
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 1 cut(s) 158
Sau96I GGNCC 2 cut(s) 199, 200
ScaI AGTACT 1 cut(s) 58
SchI GAGTC 1 cut(s) 160
SduI GDGCHC 2 cut(s) 108, 203
SetI ASST 3 cut(s) 24, 137, 175
SfcI CTRYAG 1 cut(s) 39
SgeI CNNG 3 cut(s) 23, 128, 188
SsiI CCGC 2 cut(s) 87, 126
TaaI ACNGT 1 cut(s) 209
TaqI TCGA 1 cut(s) 117
TatI WGTACW 1 cut(s) 56
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 2 cut(s) 70, 214
TspDTI ATGAA 2 cut(s) 17, 139
TspGWI ACGGA 1 cut(s) 127
TspRI CASTG 2 cut(s) 70, 214
ZrmI AGTACT 1 cut(s) 58
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.