Rw0G011200

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Contig00485
Physical Location & Seq
Forward (+)
11514 .. 12900
1387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw0G011200.1

Sequence Viewer

Length: 237 bp
ATGAACCCACAAGTGGATAAGCTGGTGAGGGGGACAACAATAGTGGCTACTATCACTGCTTCCTATTTTCTCTTAACCGCTGATTATGGCCCTGAGCCCAATGTTCTCGACCCTATTAAGAAGGCAATACAGTCTGCAGAAAGCTCCGTTAAAGACTTCATCTTTGGATCAAAGACTCAACCTCCAGAAAGCCAAGTGAAGGAGCTGGGCCCTAACAGCGCAAAGGAACGTCCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.46

Weight (kDa)

6.16

Isoelectric Point (pI)

26.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 78
AclWI GGATC 1 cut(s) 175
AfiI CCNNNNNNNGG 2 cut(s) 13, 199
AluBI AGCT 3 cut(s) 22, 144, 205
AluI AGCT 3 cut(s) 22, 144, 205
AlwI GGATC 1 cut(s) 175
AoxI GGCC 2 cut(s) 88, 208
ApaI GGGCCC 1 cut(s) 212
ArsI GACNNNNNNTTYG 2 cut(s) 146, 178
AspLEI GCGC 1 cut(s) 221
AspS9I GGNCC 3 cut(s) 89, 208, 209
AsuHPI GGTGA 1 cut(s) 37
BaeGI GKGCMC 1 cut(s) 212
BanII GRGCYC 2 cut(s) 99, 212
BfmI CTRYAG 1 cut(s) 135
BmgT120I GGNCC 3 cut(s) 89, 208, 209
BmiI GGNNCC 1 cut(s) 210
BpmI CTGGAG 1 cut(s) 168
Bpu10I CCTNAGC 1 cut(s) 93
BsaXI ACNNNNNCTCC 2 cut(s) 166, 196
Bsc4I CCNNNNNNNGG 2 cut(s) 13, 199
BseLI CCNNNNNNNGG 2 cut(s) 13, 199
BseMII CTCAG 1 cut(s) 84
BseSI GKGCMC 1 cut(s) 212
BseYI CCCAGC 1 cut(s) 205
BshFI GGCC 2 cut(s) 90, 210
BslFI GGGAC 1 cut(s) 46
BslI CCNNNNNNNGG 2 cut(s) 13, 199
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 2 cut(s) 90, 210
Bsp120I GGGCCC 1 cut(s) 208
Bsp1286I GDGCHC 2 cut(s) 99, 212
Bsp143I GATC 1 cut(s) 167
BspACI CCGC 1 cut(s) 78
BspANI GGCC 2 cut(s) 90, 210
BspCNI CTCAG 1 cut(s) 85
BspLI GGNNCC 1 cut(s) 210
BspMAI CTGCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 175
BssMI GATC 1 cut(s) 167
Bst4CI ACNGT 1 cut(s) 132
BstDEI CTNAG 2 cut(s) 93, 234
BstHHI GCGC 1 cut(s) 221
BstKTI GATC 1 cut(s) 170
BstMBI GATC 1 cut(s) 167
BstMWI GCNNNNNNNGC 1 cut(s) 216
BstSFI CTRYAG 1 cut(s) 135
BstSLI GKGCMC 1 cut(s) 212
BsuRI GGCC 2 cut(s) 90, 210
BtsI GCAGTG 1 cut(s) 54
BtsIMutI CAGTG 1 cut(s) 54
CfoI GCGC 1 cut(s) 221
Cfr13I GGNCC 3 cut(s) 89, 208, 209
CspCI CAANNNNNGTGG 2 cut(s) 24, 59
CviJI RGCY 8 cut(s) 22, 47, 90, 97, 144, 192, 205, 210
CviKI_1 RGCY 8 cut(s) 22, 47, 90, 97, 144, 192, 205, 210
DdeI CTNAG 2 cut(s) 93, 234
DpnI GATC 1 cut(s) 169
DpnII GATC 1 cut(s) 167
Eco24I GRGCYC 2 cut(s) 99, 212
EcoO109I RGGNCCY 1 cut(s) 209
EcoT38I GRGCYC 2 cut(s) 99, 212
FaiI YATR 1 cut(s) 87
FaqI GGGAC 1 cut(s) 46
FriOI GRGCYC 2 cut(s) 99, 212
GlaI GCGC 1 cut(s) 220
GsaI CCCAGC 1 cut(s) 209
GsuI CTGGAG 1 cut(s) 168
HaeIII GGCC 2 cut(s) 90, 210
HhaI GCGC 1 cut(s) 221
Hin6I GCGC 1 cut(s) 219
HinP1I GCGC 1 cut(s) 219
HinfI GANTC 1 cut(s) 175
HphI GGTGA 1 cut(s) 37
Hpy188III TCNNGA 2 cut(s) 107, 185
HpyAV CCTTC 2 cut(s) 115, 193
HpyCH4III ACNGT 1 cut(s) 132
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 1 cut(s) 137
HpyF10VI GCNNNNNNNGC 1 cut(s) 216
HpyF3I CTNAG 2 cut(s) 93, 234
HpySE526I ACGT 1 cut(s) 229
HspAI GCGC 1 cut(s) 219
Kzo9I GATC 1 cut(s) 167
LmnI GCTCC 2 cut(s) 149, 202
LpnPI CCDG 4 cut(s) 8, 105, 191, 198
MaeII ACGT 1 cut(s) 229
MalI GATC 1 cut(s) 169
MboI GATC 1 cut(s) 167
MhlI GDGCHC 2 cut(s) 99, 212
MlyI GAGTC 1 cut(s) 169
MnlI CCTC 2 cut(s) 21, 192
MseI TTAA 3 cut(s) 74, 117, 150
MspA1I CMGCKG 1 cut(s) 80
MwoI GCNNNNNNNGC 1 cut(s) 216
NdeII GATC 1 cut(s) 167
NlaIV GGNNCC 1 cut(s) 210
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspFI CCCAGC 1 cut(s) 205
PspN4I GGNNCC 1 cut(s) 210
PspOMI GGGCCC 1 cut(s) 208
PspPI GGNCC 3 cut(s) 89, 208, 209
PstI CTGCAG 1 cut(s) 139
SaqAI TTAA 3 cut(s) 74, 117, 150
Sau3AI GATC 1 cut(s) 167
Sau96I GGNCC 3 cut(s) 89, 208, 209
SchI GAGTC 1 cut(s) 169
SduI GDGCHC 2 cut(s) 99, 212
SetI ASST 5 cut(s) 24, 146, 184, 207, 232
SfcI CTRYAG 1 cut(s) 135
SgeI CNNG 7 cut(s) 23, 35, 104, 119, 197, 206, 218
SsiI CCGC 1 cut(s) 78
TaaI ACNGT 1 cut(s) 132
TaiI ACGT 1 cut(s) 232
TaqI TCGA 1 cut(s) 108
Tru1I TTAA 3 cut(s) 74, 117, 150
Tru9I TTAA 3 cut(s) 74, 117, 150
TscAI CASTG 1 cut(s) 61
TspDTI ATGAA 2 cut(s) 17, 148
TspGWI ACGGA 1 cut(s) 136
TspRI CASTG 1 cut(s) 61
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.