RchiOBHm_Chr1g0374451

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
62260629 .. 62262328
1700 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ59826

Sequence Viewer

Length: 276 bp
ATGCAAAACAGGGAAATTGATGAAAGTGCAGGAGATTTTTTTTTTCCTTTCGGGATGTCCCGGTCCCGTCCCGATCCCGTCCCGGTCCCGTTCGGGTTCGGGATGGTCGGGATCAATTCTCAAAAAGTGCCAAACCGTCCCGTCCCGTCCCGAGTTTTATTTCCGGGTCCGGGACCGGGATCACCAGAATTTCGTCCCGTCCCGTCCCATGCCCAGCCCTACCTGAAATTATTGATATGGTCTCCCATTTTCACAGTGGGGGTCCTTGTCAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.01

Weight (kDa)

9.68

Isoelectric Point (pI)

75.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 68, 119, 187
AcsI RAATTY 1 cut(s) 188
AfiI CCNNNNNNNGG 2 cut(s) 170, 176
Alw26I GTCTC 1 cut(s) 246
AlwI GGATC 3 cut(s) 68, 119, 187
Ama87I CYCGRG 1 cut(s) 150
ApoI RAATTY 1 cut(s) 188
AspS9I GGNCC 5 cut(s) 63, 85, 167, 173, 262
AsuC2I CCSGG 5 cut(s) 61, 83, 165, 171, 177
AsuHPI GGTGA 1 cut(s) 174
AvaI CYCGRG 1 cut(s) 150
AvaII GGWCC 5 cut(s) 63, 85, 167, 173, 262
BccI CCATC 1 cut(s) 97
BcnI CCSGG 5 cut(s) 61, 83, 165, 171, 177
BcoDI GTCTC 1 cut(s) 246
Bme1390I CCNGG 5 cut(s) 61, 83, 165, 171, 177
Bme18I GGWCC 5 cut(s) 63, 85, 167, 173, 262
BmeT110I CYCGRG 1 cut(s) 150
BmgT120I GGNCC 5 cut(s) 63, 85, 167, 173, 262
BmiI GGNNCC 5 cut(s) 65, 87, 168, 174, 263
BmrFI CCNGG 5 cut(s) 61, 83, 165, 171, 177
BpuMI CCSGG 5 cut(s) 61, 83, 165, 171, 177
BsaI GGTCTC 1 cut(s) 246
Bsc4I CCNNNNNNNGG 2 cut(s) 170, 176
BseGI GGATG 2 cut(s) 60, 108
BseLI CCNNNNNNNGG 2 cut(s) 170, 176
BseYI CCCAGC 1 cut(s) 213
BsgI GTGCAG 1 cut(s) 48
BsiHKCI CYCGRG 1 cut(s) 150
BsiSI CCGG 5 cut(s) 61, 83, 164, 170, 176
BslI CCNNNNNNNGG 2 cut(s) 170, 176
BsmAI GTCTC 1 cut(s) 246
Bso31I GGTCTC 1 cut(s) 246
BsoBI CYCGRG 1 cut(s) 150
Bsp143I GATC 3 cut(s) 73, 111, 179
BspLI GGNNCC 5 cut(s) 65, 87, 168, 174, 263
BspPI GGATC 3 cut(s) 68, 119, 187
BspTNI GGTCTC 1 cut(s) 246
BssMI GATC 3 cut(s) 73, 111, 179
Bst4CI ACNGT 2 cut(s) 137, 256
BstF5I GGATG 2 cut(s) 60, 108
BstKTI GATC 3 cut(s) 76, 114, 182
BstMAI GTCTC 1 cut(s) 246
BstMBI GATC 3 cut(s) 73, 111, 179
BstSCI CCNGG 5 cut(s) 59, 81, 163, 169, 175
BtsCI GGATG 2 cut(s) 60, 108
BtsIMutI CAGTG 1 cut(s) 261
Cfr13I GGNCC 5 cut(s) 63, 85, 167, 173, 262
CviAII CATG 1 cut(s) 209
CviJI RGCY 1 cut(s) 217
CviKI_1 RGCY 1 cut(s) 217
DpnI GATC 3 cut(s) 75, 113, 181
DpnII GATC 3 cut(s) 73, 111, 179
Eco31I GGTCTC 1 cut(s) 246
Eco47I GGWCC 5 cut(s) 63, 85, 167, 173, 262
Eco88I CYCGRG 1 cut(s) 150
EcoO109I RGGNCCY 1 cut(s) 262
FaeI CATG 1 cut(s) 212
FaiI YATR 2 cut(s) 210, 238
FatI CATG 1 cut(s) 208
FokI GGATG 2 cut(s) 67, 115
GsaI CCCAGC 1 cut(s) 217
HapII CCGG 5 cut(s) 61, 83, 164, 170, 176
Hin1II CATG 1 cut(s) 212
HpaII CCGG 5 cut(s) 61, 83, 164, 170, 176
HphI GGTGA 1 cut(s) 174
Hpy188III TCNNGA 5 cut(s) 52, 71, 100, 109, 150
HpyCH4III ACNGT 2 cut(s) 137, 256
HpyCH4V TGCA 2 cut(s) 4, 29
Hsp92II CATG 1 cut(s) 212
Kzo9I GATC 3 cut(s) 73, 111, 179
LpnPI CCDG 9 cut(s) 15, 74, 96, 177, 183, 189, 198, 227, 236
MalI GATC 3 cut(s) 75, 113, 181
MboI GATC 3 cut(s) 73, 111, 179
MluCI AATT 5 cut(s) 15, 115, 188, 227, 271
MseI TTAA 1 cut(s) 274
MspI CCGG 5 cut(s) 61, 83, 164, 170, 176
MspR9I CCNGG 5 cut(s) 61, 83, 165, 171, 177
NciI CCSGG 5 cut(s) 61, 83, 165, 171, 177
NdeII GATC 3 cut(s) 73, 111, 179
NlaIII CATG 1 cut(s) 212
NlaIV GGNNCC 5 cut(s) 65, 87, 168, 174, 263
PfoI TCCNGGA 1 cut(s) 169
PpuMI RGGWCCY 1 cut(s) 262
Psp5II RGGWCCY 1 cut(s) 262
PspFI CCCAGC 1 cut(s) 213
PspN4I GGNNCC 5 cut(s) 65, 87, 168, 174, 263
PspPI GGNCC 5 cut(s) 63, 85, 167, 173, 262
PspPPI RGGWCCY 1 cut(s) 262
SaqAI TTAA 1 cut(s) 274
Sau3AI GATC 3 cut(s) 73, 111, 179
Sau96I GGNCC 5 cut(s) 63, 85, 167, 173, 262
ScrFI CCNGG 5 cut(s) 61, 83, 165, 171, 177
SetI ASST 1 cut(s) 225
SinI GGWCC 5 cut(s) 63, 85, 167, 173, 262
Sse9I AATT 5 cut(s) 15, 115, 188, 227, 271
StyD4I CCNGG 5 cut(s) 59, 81, 163, 169, 175
TaaI ACNGT 2 cut(s) 137, 256
TasI AATT 5 cut(s) 15, 115, 188, 227, 271
Tru1I TTAA 1 cut(s) 274
Tru9I TTAA 1 cut(s) 274
TscAI CASTG 1 cut(s) 261
TspDTI ATGAA 1 cut(s) 36
TspRI CASTG 1 cut(s) 261
VpaK11BI GGWCC 5 cut(s) 63, 85, 167, 173, 262
XapI RAATTY 1 cut(s) 188
XcmI CCANNNNNNNNNTGG 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.