Rh3CG346600

Cleavage and polyadenylation specificity factor subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
39464430 .. 39464748
319 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG346600.1

Sequence Viewer

Length: 225 bp
ATGTCTGGTAAACCGACCAAAATTGATCTGGACAAGGACACCCGAATTGATGTGCGATGCCAGATTCATCAATTGACTTTCAGTCCTCATACAGATGCCAAAGGGATTATGGATTTGGTGAAGTTTCTTTCTCCCAAGCACGTGATACTTGTTCATGGTGAGAAGCCTAGGATGGCTACTCTGAAAGGAAGAATTCAATCCGAACTGGGAATTCAAAGTTGCTGA

Protein Analysis

74

Amino Acids

8.31

Weight (kDa)

9.39

Isoelectric Point (pI)

35.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RMMBL PF07521 15 - 72 9.6e-17 Zn-dependent metallo-hydrolase RNA specificity domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 192, 210
AcvI CACGTG 1 cut(s) 142
AgsI TTSAA 2 cut(s) 197, 215
AhdI GACNNNNNGTC 1 cut(s) 81
ApoI RAATTY 2 cut(s) 192, 210
AspA2I CCTAGG 1 cut(s) 167
AsuHPI GGTGA 2 cut(s) 130, 170
AvrII CCTAGG 1 cut(s) 167
BbrPI CACGTG 1 cut(s) 142
BccI CCATC 1 cut(s) 166
BfaI CTAG 1 cut(s) 168
BlnI CCTAGG 1 cut(s) 167
BmeRI GACNNNNNGTC 1 cut(s) 81
BmrI ACTGGG 1 cut(s) 215
BmsI GCATC 2 cut(s) 47, 85
BmuI ACTGGG 1 cut(s) 215
BsaAI YACGTR 1 cut(s) 142
BsaJI CCNNGG 1 cut(s) 167
Bse1I ACTGG 1 cut(s) 210
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 210
Bsp143I GATC 1 cut(s) 25
BsrI ACTGG 1 cut(s) 210
BssECI CCNNGG 1 cut(s) 167
BssMI GATC 1 cut(s) 25
BssT1I CCWWGG 1 cut(s) 167
BstBAI YACGTR 1 cut(s) 142
BstF5I GGATG 1 cut(s) 177
BstKTI GATC 1 cut(s) 28
BstMBI GATC 1 cut(s) 25
BtgZI GCGATG 1 cut(s) 70
BtsCI GGATG 1 cut(s) 177
CviAII CATG 1 cut(s) 155
CviJI RGCY 2 cut(s) 166, 176
CviKI_1 RGCY 2 cut(s) 166, 176
DpnI GATC 1 cut(s) 27
DpnII GATC 1 cut(s) 25
DriI GACNNNNNGTC 1 cut(s) 81
Eam1105I GACNNNNNGTC 1 cut(s) 81
Eco130I CCWWGG 1 cut(s) 167
Eco72I CACGTG 1 cut(s) 142
EcoRI GAATTC 2 cut(s) 192, 210
EcoT14I CCWWGG 1 cut(s) 167
ErhI CCWWGG 1 cut(s) 167
FaeI CATG 1 cut(s) 158
FaiI YATR 3 cut(s) 90, 110, 156
FatI CATG 1 cut(s) 154
FokI GGATG 1 cut(s) 184
FspBI CTAG 1 cut(s) 168
Hin1II CATG 1 cut(s) 158
HinfI GANTC 1 cut(s) 64
HphI GGTGA 2 cut(s) 130, 170
Hpy166II GTNNAC 1 cut(s) 11
Hpy188I TCNGA 2 cut(s) 183, 202
Hpy188III TCNNGA 1 cut(s) 29
Hpy8I GTNNAC 1 cut(s) 11
HpyCH4IV ACGT 1 cut(s) 141
HpySE526I ACGT 1 cut(s) 141
Hsp92II CATG 1 cut(s) 158
Kzo9I GATC 1 cut(s) 25
LpnPI CCDG 3 cut(s) 14, 74, 191
LweI GCATC 2 cut(s) 47, 85
MaeI CTAG 1 cut(s) 168
MaeII ACGT 1 cut(s) 141
MalI GATC 1 cut(s) 27
MboI GATC 1 cut(s) 25
MboII GAAGA 1 cut(s) 201
MfeI CAATTG 1 cut(s) 71
MluCI AATT 5 cut(s) 21, 45, 71, 192, 210
MnlI CCTC 1 cut(s) 96
MslI CAYNNNNRTG 1 cut(s) 93
MunI CAATTG 1 cut(s) 71
NdeII GATC 1 cut(s) 25
NlaIII CATG 1 cut(s) 158
PfeI GAWTC 1 cut(s) 64
PmaCI CACGTG 1 cut(s) 142
PmlI CACGTG 1 cut(s) 142
Ppu21I YACGTR 1 cut(s) 142
PspCI CACGTG 1 cut(s) 142
RseI CAYNNNNRTG 1 cut(s) 93
Sau3AI GATC 1 cut(s) 25
SetI ASST 1 cut(s) 144
SfaNI GCATC 2 cut(s) 47, 85
SmiMI CAYNNNNRTG 1 cut(s) 93
Sse9I AATT 5 cut(s) 21, 45, 71, 192, 210
SspMI CTAG 1 cut(s) 168
StyI CCWWGG 1 cut(s) 167
TaiI ACGT 1 cut(s) 144
TasI AATT 5 cut(s) 21, 45, 71, 192, 210
TfiI GAWTC 1 cut(s) 64
TspDTI ATGAA 2 cut(s) 56, 143
XapI RAATTY 2 cut(s) 192, 210
XcmI CCANNNNNNNNNTGG 2 cut(s) 25, 106
XmaJI CCTAGG 1 cut(s) 167
XspI CTAG 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.