Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2C

Orthogroup ID

OG0013739

Physical Location & Seq

Genomic Coordinates Forward (+)

13324678 .. 13327413

Gene Structure 2736 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2CG153100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 177 bp

ATGTCTGGTAAACCGACCAAAATTGATCTGGACAAGGACACCCGAATTGATGTGCGATGCCAGTTGGAAGGTTCTGGAAACTGGCCTATGGATGATGTAGCAATTGAGAAAACTAAATCAGCATTCCTTCTTCAAATCGGAGAGAGGTGGGTGGACTGGCGTTGCTCTCAATACTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko03008 map03008

Pfam Domains

Protein Families

Nrap Nrap_D2 Nrap_D3 Nrap_D4 Nrap_D5 Nrap_D6

Protein Analysis

58

Amino Acids

6.73

Weight (kDa)

5.16

Isoelectric Point (pI)

23.01

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Nrap_D4	PF17405	15 - 49	2.4e-12	Nrap protein nucleotidyltransferase domain 4

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013739)

Species	Orthologous Gene IDs
prunus_persica	Prupe.3G065700_v2.0.a1 Prupe.3G065900_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0319151 RchiOBHm_Chr1g0374451 RchiOBHm_Chr2g0101461 RchiOBHm_Chr6g0263901 RchiOBHm_Chr6g0304581
rosa_multiflora	Rmu_sc0004670.1_g000026 Rmu_sc0012551.1_g000001
rosa_roxburghii	Rroxscaffold_4G00319370 Rroxscaffold_6G00425380
rosa_rugosa	Rorug02G0653500 Rorug02G0653500 Rorug02G0653500
rosa_samantha	Rh2CG153100 Rh3CG346600 Rh4BG328800 Rh5DG226000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AgsI	TTSAA	1 cut(s)	134
AoxI	GGCC	1 cut(s)	83
BfaI	CTAG	1 cut(s)	175
BmsI	GCATC	1 cut(s)	47
Bse1I	ACTGG	3 cut(s)	61, 86, 161
BseGI	GGATG	1 cut(s)	97
BseNI	ACTGG	3 cut(s)	61, 86, 161
BshFI	GGCC	1 cut(s)	85
BsmI	GAATGC	1 cut(s)	122
BsnI	GGCC	1 cut(s)	85
Bsp143I	GATC	1 cut(s)	25
BspANI	GGCC	1 cut(s)	85
BsrI	ACTGG	3 cut(s)	61, 86, 161
BssMI	GATC	1 cut(s)	25
BstF5I	GGATG	1 cut(s)	97
BstKTI	GATC	1 cut(s)	28
BstMBI	GATC	1 cut(s)	25
BsuRI	GGCC	1 cut(s)	85
BtgZI	GCGATG	1 cut(s)	70
BtsCI	GGATG	1 cut(s)	97
CviJI	RGCY	1 cut(s)	85
CviKI_1	RGCY	1 cut(s)	85
DpnI	GATC	1 cut(s)	27
DpnII	GATC	1 cut(s)	25
FaiI	YATR	1 cut(s)	89
FokI	GGATG	1 cut(s)	104
FspBI	CTAG	1 cut(s)	175
HaeIII	GGCC	1 cut(s)	85
Hpy166II	GTNNAC	2 cut(s)	11, 154
Hpy188I	TCNGA	1 cut(s)	140
Hpy188III	TCNNGA	2 cut(s)	29, 75
Hpy8I	GTNNAC	2 cut(s)	11, 154
HpyAV	CCTTC	2 cut(s)	62, 137
Kzo9I	GATC	1 cut(s)	25
LpnPI	CCDG	5 cut(s)	14, 60, 67, 74, 142
LweI	GCATC	1 cut(s)	47
MaeI	CTAG	1 cut(s)	175
MalI	GATC	1 cut(s)	27
MboI	GATC	1 cut(s)	25
MboII	GAAGA	1 cut(s)	122
MfeI	CAATTG	1 cut(s)	102
MluCI	AATT	3 cut(s)	21, 45, 102
MmeI	TCCRAC	1 cut(s)	45
MnlI	CCTC	1 cut(s)	138
MunI	CAATTG	1 cut(s)	102
Mva1269I	GAATGC	1 cut(s)	122
NdeII	GATC	1 cut(s)	25
PctI	GAATGC	1 cut(s)	122
Sau3AI	GATC	1 cut(s)	25
SetI	ASST	2 cut(s)	73, 149
SfaNI	GCATC	1 cut(s)	47
SgeI	CNNG	8 cut(s)	18, 41, 46, 54, 73, 87, 94, 169
Sse9I	AATT	3 cut(s)	21, 45, 102
SspMI	CTAG	1 cut(s)	175
TasI	AATT	3 cut(s)	21, 45, 102
XcmI	CCANNNNNNNNNTGG	1 cut(s)	25
XspI	CTAG	1 cut(s)	175

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.