Rroxscaffold_4G00319370
ERF Family

Metallo-beta-lactamase superfamily domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0013739
Physical Location & Seq
Forward (+)
47155811 .. 47159395
3585 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00319370.1

Sequence Viewer

Length: 222 bp
ATGGATCTGGTGAAGTTTCTTTCTCCCAAGCATGTGATACTTGTTCATGGTGAGAAGCCTAGGATGGCTACTCTGAAAGGAAGAATTCAATCCGAACGGGAATTCAAAGACCGAAGAGGCTTAATCTTGATCAAACCCGAACCACGAGAGCTGTCATGTGCCAAGTATGGCTTTGAGGAGATGAATCAGCACGCTTGCTTGGTGCTTGTTGATTTTCCGTGA

Protein Analysis

73

Amino Acids

8.49

Weight (kDa)

9.1

Isoelectric Point (pI)

44.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RMMBL PF07521 1 - 33 2.1e-06 Zn-dependent metallo-hydrolase RNA specificity domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 2 cut(s) 84, 101
AgsI TTSAA 2 cut(s) 89, 106
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
AlwI GGATC 1 cut(s) 12
ApoI RAATTY 2 cut(s) 84, 101
AspA2I CCTAGG 1 cut(s) 59
AsuHPI GGTGA 2 cut(s) 22, 62
AvrII CCTAGG 1 cut(s) 59
BauI CACGAG 1 cut(s) 144
BccI CCATC 1 cut(s) 58
BclI TGATCA 1 cut(s) 129
BfaI CTAG 1 cut(s) 60
BlnI CCTAGG 1 cut(s) 59
BsaJI CCNNGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 59
BseGI GGATG 1 cut(s) 69
BseRI GAGGAG 1 cut(s) 191
Bsp143I GATC 2 cut(s) 4, 129
BspPI GGATC 1 cut(s) 12
BssECI CCNNGG 1 cut(s) 59
BssMI GATC 2 cut(s) 4, 129
BssSI CACGAG 1 cut(s) 144
BssT1I CCWWGG 1 cut(s) 59
Bst2BI CACGAG 1 cut(s) 144
Bst6I CTCTTC 1 cut(s) 109
BstC8I GCNNGC 2 cut(s) 192, 196
BstF5I GGATG 1 cut(s) 69
BstKTI GATC 2 cut(s) 7, 132
BstMBI GATC 2 cut(s) 4, 129
BstNSI RCATGY 1 cut(s) 35
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BtsCI GGATG 1 cut(s) 69
Cac8I GCNNGC 2 cut(s) 192, 196
CviAII CATG 3 cut(s) 32, 47, 156
CviJI RGCY 5 cut(s) 58, 68, 120, 151, 171
CviKI_1 RGCY 5 cut(s) 58, 68, 120, 151, 171
DpnI GATC 2 cut(s) 6, 131
DpnII GATC 2 cut(s) 4, 129
Eam1104I CTCTTC 1 cut(s) 109
EarI CTCTTC 1 cut(s) 109
Eco130I CCWWGG 1 cut(s) 59
EcoRI GAATTC 2 cut(s) 84, 101
EcoT14I CCWWGG 1 cut(s) 59
ErhI CCWWGG 1 cut(s) 59
FaeI CATG 3 cut(s) 35, 50, 159
FaiI YATR 4 cut(s) 33, 48, 157, 168
FalI AAGNNNNNCTT 2 cut(s) 155, 187
FatI CATG 3 cut(s) 31, 46, 155
FbaI TGATCA 1 cut(s) 129
FokI GGATG 1 cut(s) 76
FspBI CTAG 1 cut(s) 60
Hin1II CATG 3 cut(s) 35, 50, 159
HinfI GANTC 1 cut(s) 184
HphI GGTGA 2 cut(s) 22, 62
Hpy188I TCNGA 2 cut(s) 75, 94
Hpy188III TCNNGA 1 cut(s) 127
Hsp92II CATG 3 cut(s) 35, 50, 159
Ksp22I TGATCA 1 cut(s) 129
Kzo9I GATC 2 cut(s) 4, 129
MaeI CTAG 1 cut(s) 60
MalI GATC 2 cut(s) 6, 131
MboI GATC 2 cut(s) 4, 129
MboII GAAGA 2 cut(s) 93, 126
MflI RGATCY 1 cut(s) 4
MluCI AATT 2 cut(s) 84, 101
MnlI CCTC 2 cut(s) 110, 169
MseI TTAA 1 cut(s) 122
NdeII GATC 2 cut(s) 4, 129
NlaIII CATG 3 cut(s) 35, 50, 159
NspI RCATGY 1 cut(s) 35
PfeI GAWTC 1 cut(s) 184
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 2 cut(s) 4, 129
SetI ASST 1 cut(s) 153
Sse9I AATT 2 cut(s) 84, 101
SspMI CTAG 1 cut(s) 60
StyI CCWWGG 1 cut(s) 59
TaqII GACCGA 1 cut(s) 126
TasI AATT 2 cut(s) 84, 101
TfiI GAWTC 1 cut(s) 184
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspDTI ATGAA 2 cut(s) 35, 197
TspGWI ACGGA 1 cut(s) 207
XapI RAATTY 2 cut(s) 84, 101
XceI RCATGY 1 cut(s) 35
XmaJI CCTAGG 1 cut(s) 59
XspI CTAG 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.