RchiOBHm_Chr2g0123311

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
36433048 .. 36435453
2406 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49562

Sequence Viewer

Length: 162 bp
ATGCTTGCCAAGGTTAGAGTTCACCACTATAATGGAAGGATGTTGGAAGCTTTATTCAGCCAGAGCGTATCAGGCAAATGTGGATCAGACCCTTTTCTTCTGAGACTGATGACAACTTACTCATGCGTGATGAGTGACACTCTTGAGACATTATGGAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

6.08

Weight (kDa)

8.8

Isoelectric Point (pI)

45.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 91
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw26I GTCTC 2 cut(s) 97, 140
AlwI GGATC 1 cut(s) 91
AsuHPI GGTGA 1 cut(s) 14
BcoDI GTCTC 2 cut(s) 97, 140
BplI GAGNNNNNCTC 2 cut(s) 124, 156
BsaJI CCNNGG 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 9
BseGI GGATG 1 cut(s) 45
BseMII CTCAG 1 cut(s) 92
BsmAI GTCTC 2 cut(s) 97, 140
Bsp143I GATC 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 93
BspPI GGATC 1 cut(s) 91
BssECI CCNNGG 1 cut(s) 9
BssMI GATC 1 cut(s) 83
BssT1I CCWWGG 1 cut(s) 9
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 101
BstF5I GGATG 1 cut(s) 45
BstKTI GATC 1 cut(s) 86
BstMAI GTCTC 2 cut(s) 97, 140
BstMBI GATC 1 cut(s) 83
BstMWI GCNNNNNNNGC 1 cut(s) 72
BstXI CCANNNNNNTGG 1 cut(s) 32
BtsCI GGATG 1 cut(s) 45
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 123
CviJI RGCY 2 cut(s) 50, 60
CviKI_1 RGCY 2 cut(s) 50, 60
DdeI CTNAG 1 cut(s) 101
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
Eco130I CCWWGG 1 cut(s) 9
EcoT14I CCWWGG 1 cut(s) 9
ErhI CCWWGG 1 cut(s) 9
FaeI CATG 1 cut(s) 126
FaiI YATR 3 cut(s) 30, 124, 154
FatI CATG 1 cut(s) 122
FokI GGATG 1 cut(s) 52
Hin1II CATG 1 cut(s) 126
HindIII AAGCTT 1 cut(s) 48
HphI GGTGA 1 cut(s) 14
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 88, 102
Hpy188III TCNNGA 1 cut(s) 143
Hpy8I GTNNAC 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 30
HpyF10VI GCNNNNNNNGC 1 cut(s) 72
HpyF3I CTNAG 1 cut(s) 101
Hsp92II CATG 1 cut(s) 126
Kzo9I GATC 1 cut(s) 83
LpnPI CCDG 2 cut(s) 57, 74
MaeIII GTNAC 1 cut(s) 134
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MboII GAAGA 1 cut(s) 89
MmeI TCCRAC 1 cut(s) 24
MnlI CCTC 1 cut(s) 150
MslI CAYNNNNRTG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 72
NdeII GATC 1 cut(s) 83
NlaIII CATG 1 cut(s) 126
NmuCI GTSAC 1 cut(s) 134
RseI CAYNNNNRTG 1 cut(s) 30
Sau3AI GATC 1 cut(s) 83
SetI ASST 3 cut(s) 15, 52, 161
SgeI CNNG 7 cut(s) 17, 22, 73, 84, 135, 139, 155
SmiMI CAYNNNNRTG 1 cut(s) 30
SmlI CTYRAG 1 cut(s) 143
SmoI CTYRAG 1 cut(s) 143
StyI CCWWGG 1 cut(s) 9
TseFI GTSAC 1 cut(s) 134
Tsp45I GTSAC 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.