Rh4CG123200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4C
Physical Location & Seq
Forward (+)
23684767 .. 23685150
384 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4CG123200.1

Sequence Viewer

Length: 384 bp
ATGGACAAGTGGTCTTGTCGTCAGGCATTTGGCGGTAACTTTTTCGCTATTTCTAGCGACTCCAAAGCTTTTACAACTCTCTCCTATTACGCCAGTGTCCTGGGCTGCCAGGCGTTGGAGGTTCAAGGCCTCTTAGTTCGATCCAAGGTTGCTACTTCATCGAGTGGTGGTCGCACAATGTCACGAGAATTGAAGTTGCTCGTCATTTACTATGCATCGGATGTTCCTACGCGTCCTTGTGAGCCATCATCTAATGACCTGGATGTTGAAGGTAGGGCCGTTGCTGGATTTCTAGTAGAAAGATTCTCCGTGTTAGGTAGCGTGCGTGATCTTTGTGTGAATCTCCTGACTACACCATTCATCAAATCTACAGACTTTGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

127

Amino Acids

13.82

Weight (kDa)

7.62

Isoelectric Point (pI)

37.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 115
AccII CGCG 1 cut(s) 232
AciI CCGC 1 cut(s) 33
AclWI GGATC 1 cut(s) 135
AfiI CCNNNNNNNGG 1 cut(s) 115
AflIII ACRYGT 1 cut(s) 230
AgsI TTSAA 3 cut(s) 125, 193, 269
AhdI GACNNNNNGTC 1 cut(s) 10
AjnI CCWGG 3 cut(s) 99, 108, 258
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
AlwI GGATC 1 cut(s) 135
AoxI GGCC 2 cut(s) 127, 276
ApeKI GCWGC 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 276
BauI CACGAG 1 cut(s) 183
BbvI GCAGC 1 cut(s) 92
BccI CCATC 1 cut(s) 253
BceAI ACGGC 1 cut(s) 263
BciT130I CCWGG 3 cut(s) 101, 110, 260
BfaI CTAG 2 cut(s) 54, 293
BfmI CTRYAG 1 cut(s) 369
BisI GCNGC 1 cut(s) 106
BlsI GCNGC 1 cut(s) 107
Bme1390I CCNGG 3 cut(s) 101, 110, 260
BmeRI GACNNNNNGTC 1 cut(s) 10
BmgT120I GGNCC 1 cut(s) 276
BmrFI CCNGG 3 cut(s) 101, 110, 260
BmsI GCATC 1 cut(s) 224
BsaJI CCNNGG 2 cut(s) 100, 144
Bsc4I CCNNNNNNNGG 1 cut(s) 115
Bse1I ACTGG 1 cut(s) 93
BseBI CCWGG 3 cut(s) 101, 110, 260
BseDI CCNNGG 2 cut(s) 100, 144
BseGI GGATG 2 cut(s) 226, 268
BseLI CCNNNNNNNGG 1 cut(s) 115
BseNI ACTGG 1 cut(s) 93
BseXI GCAGC 1 cut(s) 92
Bsh1236I CGCG 1 cut(s) 232
BshFI GGCC 2 cut(s) 129, 278
BslI CCNNNNNNNGG 1 cut(s) 115
BsnI GGCC 2 cut(s) 129, 278
Bsp143I GATC 2 cut(s) 140, 328
BspACI CCGC 1 cut(s) 33
BspANI GGCC 2 cut(s) 129, 278
BspFNI CGCG 1 cut(s) 232
BspPI GGATC 1 cut(s) 135
BsrI ACTGG 1 cut(s) 93
BssECI CCNNGG 2 cut(s) 100, 144
BssMI GATC 2 cut(s) 140, 328
BssSI CACGAG 1 cut(s) 183
BssT1I CCWWGG 1 cut(s) 144
Bst2BI CACGAG 1 cut(s) 183
Bst2UI CCWGG 3 cut(s) 101, 110, 260
BstC8I GCNNGC 1 cut(s) 323
BstDEI CTNAG 1 cut(s) 133
BstF5I GGATG 2 cut(s) 226, 268
BstFNI CGCG 1 cut(s) 232
BstKTI GATC 2 cut(s) 143, 331
BstMBI GATC 2 cut(s) 140, 328
BstNI CCWGG 3 cut(s) 101, 110, 260
BstSCI CCNGG 3 cut(s) 99, 108, 258
BstSFI CTRYAG 1 cut(s) 369
BstUI CGCG 1 cut(s) 232
BstV1I GCAGC 1 cut(s) 92
BstXI CCANNNNNNTGG 1 cut(s) 100
BsuRI GGCC 2 cut(s) 129, 278
BtsCI GGATG 2 cut(s) 226, 268
BtsIMutI CAGTG 1 cut(s) 100
Cac8I GCNNGC 1 cut(s) 323
Cfr13I GGNCC 1 cut(s) 276
CseI GACGC 1 cut(s) 221
CviJI RGCY 5 cut(s) 68, 105, 129, 244, 278
CviKI_1 RGCY 5 cut(s) 68, 105, 129, 244, 278
DdeI CTNAG 1 cut(s) 133
DpnI GATC 2 cut(s) 142, 330
DpnII GATC 2 cut(s) 140, 328
DriI GACNNNNNGTC 1 cut(s) 10
Eam1105I GACNNNNNGTC 1 cut(s) 10
Eco130I CCWWGG 1 cut(s) 144
Eco147I AGGCCT 1 cut(s) 129
EcoRII CCWGG 3 cut(s) 99, 108, 258
EcoT14I CCWWGG 1 cut(s) 144
EcoT22I ATGCAT 1 cut(s) 217
ErhI CCWWGG 1 cut(s) 144
FaiI YATR 1 cut(s) 213
Fnu4HI GCNGC 1 cut(s) 106
FokI GGATG 2 cut(s) 233, 275
Fsp4HI GCNGC 1 cut(s) 106
FspBI CTAG 2 cut(s) 54, 293
GluI GCNGC 1 cut(s) 106
HaeIII GGCC 2 cut(s) 129, 278
HgaI GACGC 1 cut(s) 221
HindIII AAGCTT 1 cut(s) 66
HinfI GANTC 3 cut(s) 59, 303, 340
Hpy188I TCNGA 2 cut(s) 220, 383
Hpy188III TCNNGA 2 cut(s) 183, 346
HpyAV CCTTC 1 cut(s) 263
HpyCH4V TGCA 1 cut(s) 215
HpyF3I CTNAG 1 cut(s) 133
Kzo9I GATC 2 cut(s) 140, 328
Lsp1109I GCAGC 1 cut(s) 92
LweI GCATC 1 cut(s) 224
MaeI CTAG 2 cut(s) 54, 293
MaeIII GTNAC 2 cut(s) 35, 180
MalI GATC 2 cut(s) 142, 330
MboI GATC 2 cut(s) 140, 328
MluCI AATT 1 cut(s) 188
MluI ACGCGT 1 cut(s) 230
MlyI GAGTC 1 cut(s) 53
MmeI TCCRAC 1 cut(s) 96
MnlI CCTC 2 cut(s) 112, 140
Mph1103I ATGCAT 1 cut(s) 217
MspR9I CCNGG 3 cut(s) 101, 110, 260
MvaI CCWGG 3 cut(s) 101, 110, 260
MvnI CGCG 1 cut(s) 232
NdeII GATC 2 cut(s) 140, 328
NmuCI GTSAC 1 cut(s) 180
NsiI ATGCAT 1 cut(s) 217
PceI AGGCCT 1 cut(s) 129
PfeI GAWTC 2 cut(s) 303, 340
PflFI GACNNNGTC 1 cut(s) 377
PflMI CCANNNNNTGG 1 cut(s) 115
PkrI GCNGC 1 cut(s) 107
PleI GAGTC 1 cut(s) 53
PpsI GAGTC 1 cut(s) 53
Psp6I CCWGG 3 cut(s) 99, 108, 258
PspGI CCWGG 3 cut(s) 99, 108, 258
PspPI GGNCC 1 cut(s) 276
PsyI GACNNNGTC 1 cut(s) 377
SatI GCNGC 1 cut(s) 106
Sau3AI GATC 2 cut(s) 140, 328
Sau96I GGNCC 1 cut(s) 276
SchI GAGTC 1 cut(s) 53
ScrFI CCNGG 3 cut(s) 101, 110, 260
SetI ASST 6 cut(s) 70, 123, 150, 261, 274, 319
SfaNI GCATC 1 cut(s) 224
SfcI CTRYAG 1 cut(s) 369
Sse9I AATT 1 cut(s) 188
SseBI AGGCCT 1 cut(s) 129
SsiI CCGC 1 cut(s) 33
SspMI CTAG 2 cut(s) 54, 293
StuI AGGCCT 1 cut(s) 129
StyD4I CCNGG 3 cut(s) 99, 108, 258
StyI CCWWGG 1 cut(s) 144
TaqI TCGA 2 cut(s) 139, 161
TasI AATT 1 cut(s) 188
TfiI GAWTC 2 cut(s) 303, 340
TscAI CASTG 1 cut(s) 100
TseFI GTSAC 1 cut(s) 180
TseI GCWGC 1 cut(s) 105
Tsp45I GTSAC 1 cut(s) 180
TspDTI ATGAA 2 cut(s) 147, 349
TspGWI ACGGA 1 cut(s) 298
TspRI CASTG 1 cut(s) 100
Tth111I GACNNNGTC 1 cut(s) 377
Van91I CCANNNNNTGG 1 cut(s) 115
XspI CTAG 2 cut(s) 54, 293
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.