RchiOBHm_Chr2g0162441
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0018905
Physical Location & Seq
Reverse (-)
78180444 .. 78180722
279 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53072

Sequence Viewer

Length: 279 bp
ATGGCAACAATGCCAAAACTGAAAGAAGAAGAAGAGGAAGCCATGCTGCTGCAAGGCCAAGCTAATATTTTGCACTACACGTACAACTTTGTCGAAAGCATGGCCTTGAAATGCGCTGTGGAACTTGGCATTGCAGACATCATAAACTCTCACGGCCAACCCCTAACTGTGCATCGATCAAATCACAGCACGAATTGCCTCGCCGTCCACAGACATCAATTACCTCTCGAGCCTCATGTGATTTCTCGTCTAGAAAAATGTCTTCGAGGCGACCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

92

Amino Acids

10.41

Weight (kDa)

6.21

Isoelectric Point (pI)

59.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dimerisation PF08100 25 - 57 9.8e-08 O-methyltransferase dimerisation domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018905)

Species Orthologous Gene IDs
malus_domestica MD17G1079300.v1.1 MD17G1079400.v1.1
pyrus_communis pycom09g01480
rosa_chinensis RchiOBHm_Chr2g0162441
rosa_multiflora Rmu_co8443219.1_g000001
rosa_roxburghii Rroxscaffold_2G00087920
rosa_samantha Rh2AG405000 Rh2AG563600 Rh2BG576400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 154
AfaI GTAC 1 cut(s) 83
AflIII ACRYGT 1 cut(s) 78
AgsI TTSAA 1 cut(s) 109
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
Ama87I CYCGRG 1 cut(s) 227
AoxI GGCC 3 cut(s) 55, 102, 154
ApeKI GCWGC 2 cut(s) 46, 49
AspLEI GCGC 1 cut(s) 116
AvaI CYCGRG 1 cut(s) 227
BbsI GAAGAC 1 cut(s) 254
BbvI GCAGC 2 cut(s) 33, 36
BceAI ACGGC 2 cut(s) 169, 188
BfaI CTAG 1 cut(s) 251
BisI GCNGC 2 cut(s) 47, 50
BlsI GCNGC 2 cut(s) 48, 51
BmeT110I CYCGRG 1 cut(s) 227
BmsI GCATC 1 cut(s) 181
BpiI GAAGAC 1 cut(s) 254
Bsa29I ATCGAT 1 cut(s) 175
BsaAI YACGTR 1 cut(s) 81
Bse3DI GCAATG 1 cut(s) 129
BseCI ATCGAT 1 cut(s) 175
BseMI GCAATG 1 cut(s) 129
BseXI GCAGC 2 cut(s) 33, 36
BshFI GGCC 3 cut(s) 57, 104, 156
BshVI ATCGAT 1 cut(s) 175
BsiHKCI CYCGRG 1 cut(s) 227
BsnI GGCC 3 cut(s) 57, 104, 156
BsoBI CYCGRG 1 cut(s) 227
Bsp143I GATC 1 cut(s) 176
BspANI GGCC 3 cut(s) 57, 104, 156
BspDI ATCGAT 1 cut(s) 175
BsrDI GCAATG 1 cut(s) 129
BssMI GATC 1 cut(s) 176
Bst4CI ACNGT 1 cut(s) 169
Bst6I CTCTTC 1 cut(s) 27
BstAPI GCANNNNNTGC 1 cut(s) 195
BstBAI YACGTR 1 cut(s) 81
BstHHI GCGC 1 cut(s) 116
BstKTI GATC 1 cut(s) 179
BstMBI GATC 1 cut(s) 176
BstMWI GCNNNNNNNGC 1 cut(s) 195
BstV1I GCAGC 2 cut(s) 33, 36
BstV2I GAAGAC 1 cut(s) 254
Bsu15I ATCGAT 1 cut(s) 175
BsuRI GGCC 3 cut(s) 57, 104, 156
BsuTUI ATCGAT 1 cut(s) 175
BtsIMutI CAGTG 1 cut(s) 274
CfoI GCGC 1 cut(s) 116
ClaI ATCGAT 1 cut(s) 175
Csp6I GTAC 1 cut(s) 82
CviAII CATG 3 cut(s) 43, 100, 236
CviJI RGCY 6 cut(s) 41, 57, 62, 104, 156, 232
CviKI_1 RGCY 6 cut(s) 41, 57, 62, 104, 156, 232
CviQI GTAC 1 cut(s) 82
DpnI GATC 1 cut(s) 178
DpnII GATC 1 cut(s) 176
EaeI YGGCCR 1 cut(s) 154
Eam1104I CTCTTC 1 cut(s) 27
EarI CTCTTC 1 cut(s) 27
Eco88I CYCGRG 1 cut(s) 227
FaeI CATG 3 cut(s) 46, 103, 239
FaiI YATR 4 cut(s) 44, 101, 143, 237
FatI CATG 3 cut(s) 42, 99, 235
Fnu4HI GCNGC 2 cut(s) 47, 50
Fsp4HI GCNGC 2 cut(s) 47, 50
FspBI CTAG 1 cut(s) 251
GlaI GCGC 1 cut(s) 115
GluI GCNGC 2 cut(s) 47, 50
HaeIII GGCC 3 cut(s) 57, 104, 156
HhaI GCGC 1 cut(s) 116
Hin1II CATG 3 cut(s) 46, 103, 239
Hin6I GCGC 1 cut(s) 114
HinP1I GCGC 1 cut(s) 114
Hpy166II GTNNAC 1 cut(s) 208
Hpy188III TCNNGA 2 cut(s) 227, 251
Hpy8I GTNNAC 1 cut(s) 208
HpyCH4III ACNGT 1 cut(s) 169
HpyCH4IV ACGT 1 cut(s) 80
HpyCH4V TGCA 4 cut(s) 52, 73, 134, 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 195
HpySE526I ACGT 1 cut(s) 80
Hsp92II CATG 3 cut(s) 46, 103, 239
HspAI GCGC 1 cut(s) 114
Kzo9I GATC 1 cut(s) 176
Lsp1109I GCAGC 2 cut(s) 33, 36
LweI GCATC 1 cut(s) 181
MaeI CTAG 1 cut(s) 251
MaeII ACGT 1 cut(s) 80
MalI GATC 1 cut(s) 178
MboI GATC 1 cut(s) 176
MboII GAAGA 4 cut(s) 38, 41, 44, 254
MluCI AATT 2 cut(s) 193, 218
MnlI CCTC 5 cut(s) 28, 209, 234, 243, 260
MwoI GCNNNNNNNGC 1 cut(s) 195
NdeII GATC 1 cut(s) 176
NlaIII CATG 3 cut(s) 46, 103, 239
PaeR7I CTCGAG 1 cut(s) 227
PkrI GCNGC 2 cut(s) 48, 51
Ppu21I YACGTR 1 cut(s) 81
RsaI GTAC 1 cut(s) 83
RsaNI GTAC 1 cut(s) 82
SatI GCNGC 2 cut(s) 47, 50
Sau3AI GATC 1 cut(s) 176
SetI ASST 3 cut(s) 64, 83, 226
SfaNI GCATC 1 cut(s) 181
Sfr274I CTCGAG 1 cut(s) 227
SlaI CTCGAG 1 cut(s) 227
SmlI CTYRAG 1 cut(s) 227
SmoI CTYRAG 1 cut(s) 227
Sse9I AATT 2 cut(s) 193, 218
SspI AATATT 1 cut(s) 67
SspMI CTAG 1 cut(s) 251
TaaI ACNGT 1 cut(s) 169
TaiI ACGT 1 cut(s) 83
TaqI TCGA 4 cut(s) 93, 175, 228, 265
TasI AATT 2 cut(s) 193, 218
TseI GCWGC 2 cut(s) 46, 49
XbaI TCTAGA 1 cut(s) 250
XhoI CTCGAG 1 cut(s) 227
XspI CTAG 1 cut(s) 251
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.