Rmu_co8443219.1_g000001
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8443219.1
OG0018905
Physical Location & Seq
Forward (+)
385 .. 934
550 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8443219.1_g000001.1.cds

Sequence Viewer

Length: 465 bp
atgccaaaactgaaagaagaagaaaaggaagccatgctgctgcaaggccaagctaatattttgcactacacgtacaactttgtcgaaagcatggccttgaaatgcgctgtggaacttggcattgcagacatcataaactctcacggccaacccctaactaaaaatgtcttcgaggcgaccactgatcccataagcggagataccctctacggcctaccttattcatctaagtggcttctccgcagtgaggaccaaaaccttgccccgctagtgcttatggccacttttcctaatcacttgaccccatggcaatgcctaagcaaatgcataacagacggtggatctggctttgaaaaggcacatgggtttagcttatatgacgagagatctgatgatatgagaagttgcttcaatgaggcaatggcatgtacatctaggactgtcatgaaagcagtcaaattatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

154

Amino Acids

17.17

Weight (kDa)

5.32

Isoelectric Point (pI)

52.23

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018905)

Species Orthologous Gene IDs
malus_domestica MD17G1079300.v1.1 MD17G1079400.v1.1
pyrus_communis pycom09g01480
rosa_chinensis RchiOBHm_Chr2g0162441
rosa_multiflora Rmu_co8443219.1_g000001
rosa_roxburghii Rroxscaffold_2G00087920
rosa_samantha Rh2AG405000 Rh2AG563600 Rh2BG576400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 195, 241, 266
AclWI GGATC 2 cut(s) 179, 349
AcoI YGGCCR 2 cut(s) 145, 279
AfaI GTAC 2 cut(s) 74, 430
AfiI CCNNNNNNNGG 2 cut(s) 194, 247
AflIII ACRYGT 1 cut(s) 69
AgsI TTSAA 3 cut(s) 100, 353, 412
AluBI AGCT 2 cut(s) 53, 372
AluI AGCT 2 cut(s) 53, 372
AlwI GGATC 2 cut(s) 179, 349
AoxI GGCC 5 cut(s) 46, 93, 145, 211, 279
ApeKI GCWGC 2 cut(s) 37, 40
AspLEI GCGC 1 cut(s) 107
AspS9I GGNCC 1 cut(s) 250
AvaII GGWCC 1 cut(s) 250
BalI TGGCCA 1 cut(s) 281
BbsI GAAGAC 1 cut(s) 160
BbvI GCAGC 2 cut(s) 24, 27
BceAI ACGGC 2 cut(s) 160, 226
BfaI CTAG 2 cut(s) 269, 435
BglII AGATCT 1 cut(s) 386
BisI GCNGC 2 cut(s) 38, 41
BlsI GCNGC 2 cut(s) 39, 42
Bme18I GGWCC 1 cut(s) 250
BmgT120I GGNCC 1 cut(s) 250
BpiI GAAGAC 1 cut(s) 160
BplI GAGNNNNNCTC 2 cut(s) 189, 221
Bpu10I CCTNAGC 1 cut(s) 317
BsaAI YACGTR 1 cut(s) 72
BsaJI CCNNGG 1 cut(s) 305
Bsc4I CCNNNNNNNGG 2 cut(s) 194, 247
Bse3DI GCAATG 3 cut(s) 120, 317, 426
BseDI CCNNGG 1 cut(s) 305
BseLI CCNNNNNNNGG 2 cut(s) 194, 247
BseMI GCAATG 3 cut(s) 120, 317, 426
BseXI GCAGC 2 cut(s) 24, 27
BshFI GGCC 5 cut(s) 48, 95, 147, 213, 281
BslI CCNNNNNNNGG 2 cut(s) 194, 247
BsnI GGCC 5 cut(s) 48, 95, 147, 213, 281
Bsp1407I TGTACA 1 cut(s) 428
Bsp143I GATC 3 cut(s) 184, 341, 386
Bsp19I CCATGG 1 cut(s) 305
BspACI CCGC 3 cut(s) 195, 241, 266
BspANI GGCC 5 cut(s) 48, 95, 147, 213, 281
BspHI TCATGA 1 cut(s) 444
BspPI GGATC 2 cut(s) 179, 349
BsrDI GCAATG 3 cut(s) 120, 317, 426
BsrGI TGTACA 1 cut(s) 428
BssECI CCNNGG 1 cut(s) 305
BssMI GATC 3 cut(s) 184, 341, 386
BssT1I CCWWGG 1 cut(s) 305
Bst4CI ACNGT 2 cut(s) 338, 442
BstAUI TGTACA 1 cut(s) 428
BstBAI YACGTR 1 cut(s) 72
BstDEI CTNAG 2 cut(s) 228, 317
BstDSI CCRYGG 1 cut(s) 305
BstHHI GCGC 1 cut(s) 107
BstKTI GATC 3 cut(s) 187, 344, 389
BstMBI GATC 3 cut(s) 184, 341, 386
BstNSI RCATGY 1 cut(s) 429
BstV1I GCAGC 2 cut(s) 24, 27
BstV2I GAAGAC 1 cut(s) 160
BstX2I RGATCY 2 cut(s) 341, 386
BstYI RGATCY 2 cut(s) 341, 386
BsuRI GGCC 5 cut(s) 48, 95, 147, 213, 281
BtgI CCRYGG 1 cut(s) 305
BtsI GCAGTG 1 cut(s) 250
BtsIMutI CAGTG 2 cut(s) 180, 250
CciI TCATGA 1 cut(s) 444
CfoI GCGC 1 cut(s) 107
Cfr13I GGNCC 1 cut(s) 250
Csp6I GTAC 2 cut(s) 73, 429
CviAII CATG 6 cut(s) 34, 91, 306, 362, 426, 445
CviQI GTAC 2 cut(s) 73, 429
DdeI CTNAG 2 cut(s) 228, 317
DpnI GATC 3 cut(s) 186, 343, 388
DpnII GATC 3 cut(s) 184, 341, 386
EaeI YGGCCR 2 cut(s) 145, 279
Eco130I CCWWGG 1 cut(s) 305
Eco47I GGWCC 1 cut(s) 250
EcoT14I CCWWGG 1 cut(s) 305
EcoT22I ATGCAT 1 cut(s) 329
ErhI CCWWGG 1 cut(s) 305
FaeI CATG 6 cut(s) 37, 94, 309, 365, 429, 448
FatI CATG 6 cut(s) 33, 90, 305, 361, 425, 444
FauI CCCGC 1 cut(s) 273
Fnu4HI GCNGC 2 cut(s) 38, 41
Fsp4HI GCNGC 2 cut(s) 38, 41
FspBI CTAG 2 cut(s) 269, 435
GlaI GCGC 1 cut(s) 106
GluI GCNGC 2 cut(s) 38, 41
HaeIII GGCC 5 cut(s) 48, 95, 147, 213, 281
HhaI GCGC 1 cut(s) 107
Hin1II CATG 6 cut(s) 37, 94, 309, 365, 429, 448
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
Hpy188I TCNGA 1 cut(s) 391
Hpy188III TCNNGA 1 cut(s) 445
HpyCH4III ACNGT 2 cut(s) 338, 442
HpyCH4IV ACGT 1 cut(s) 71
HpyCH4V TGCA 4 cut(s) 43, 64, 125, 327
HpyF3I CTNAG 2 cut(s) 228, 317
HpySE526I ACGT 1 cut(s) 71
Hsp92II CATG 6 cut(s) 37, 94, 309, 365, 429, 448
HspAI GCGC 1 cut(s) 105
Kzo9I GATC 3 cut(s) 184, 341, 386
LpnPI CCDG 1 cut(s) 330
Lsp1109I GCAGC 2 cut(s) 24, 27
MaeI CTAG 2 cut(s) 269, 435
MaeII ACGT 1 cut(s) 71
MalI GATC 3 cut(s) 186, 343, 388
MboI GATC 3 cut(s) 184, 341, 386
MboII GAAGA 3 cut(s) 29, 32, 160
MflI RGATCY 2 cut(s) 341, 386
MlsI TGGCCA 1 cut(s) 281
MluCI AATT 1 cut(s) 458
MluNI TGGCCA 1 cut(s) 281
MnlI CCTC 4 cut(s) 166, 215, 241, 409
Mox20I TGGCCA 1 cut(s) 281
Mph1103I ATGCAT 1 cut(s) 329
MscI TGGCCA 1 cut(s) 281
MslI CAYNNNNRTG 2 cut(s) 229, 310
Msp20I TGGCCA 1 cut(s) 281
NcoI CCATGG 1 cut(s) 305
NdeII GATC 3 cut(s) 184, 341, 386
NlaIII CATG 6 cut(s) 37, 94, 309, 365, 429, 448
NsiI ATGCAT 1 cut(s) 329
NspI RCATGY 1 cut(s) 429
PagI TCATGA 1 cut(s) 444
PkrI GCNGC 2 cut(s) 39, 42
Ppu21I YACGTR 1 cut(s) 72
PspPI GGNCC 1 cut(s) 250
PsuI RGATCY 2 cut(s) 341, 386
RsaI GTAC 2 cut(s) 74, 430
RsaNI GTAC 2 cut(s) 73, 429
RseI CAYNNNNRTG 2 cut(s) 229, 310
SatI GCNGC 2 cut(s) 38, 41
Sau3AI GATC 3 cut(s) 184, 341, 386
Sau96I GGNCC 1 cut(s) 250
SetI ASST 5 cut(s) 55, 74, 220, 261, 374
SinI GGWCC 1 cut(s) 250
SmiMI CAYNNNNRTG 2 cut(s) 229, 310
Sse9I AATT 1 cut(s) 458
SsiI CCGC 3 cut(s) 195, 241, 266
SspI AATATT 1 cut(s) 58
SspMI CTAG 2 cut(s) 269, 435
StyI CCWWGG 1 cut(s) 305
TaaI ACNGT 2 cut(s) 338, 442
TaiI ACGT 1 cut(s) 74
TaqI TCGA 2 cut(s) 84, 171
TasI AATT 1 cut(s) 458
TatI WGTACW 1 cut(s) 428
TscAI CASTG 2 cut(s) 187, 250
TseI GCWGC 2 cut(s) 37, 40
TspDTI ATGAA 2 cut(s) 213, 461
TspRI CASTG 2 cut(s) 187, 250
VpaK11BI GGWCC 1 cut(s) 250
XceI RCATGY 1 cut(s) 429
XspI CTAG 2 cut(s) 269, 435
Zsp2I ATGCAT 1 cut(s) 329
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.